ID: 1171289558

View in Genome Browser
Species Human (GRCh38)
Location 20:23974189-23974211
Sequence GGTGTCAAGAAGGGCAGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171289550_1171289558 22 Left 1171289550 20:23974144-23974166 CCAGTCAACAGTGGGTTCACTCC No data
Right 1171289558 20:23974189-23974211 GGTGTCAAGAAGGGCAGCAGTGG No data
1171289553_1171289558 1 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289558 20:23974189-23974211 GGTGTCAAGAAGGGCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171289558 Original CRISPR GGTGTCAAGAAGGGCAGCAG TGG Intergenic
No off target data available for this crispr