ID: 1171289562

View in Genome Browser
Species Human (GRCh38)
Location 20:23974215-23974237
Sequence TTGATTAGTTCTCTGGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171289555_1171289562 14 Left 1171289555 20:23974178-23974200 CCTTAGTGGCAGGTGTCAAGAAG No data
Right 1171289562 20:23974215-23974237 TTGATTAGTTCTCTGGGTAAAGG No data
1171289553_1171289562 27 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289562 20:23974215-23974237 TTGATTAGTTCTCTGGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171289562 Original CRISPR TTGATTAGTTCTCTGGGTAA AGG Intergenic
No off target data available for this crispr