ID: 1171292514

View in Genome Browser
Species Human (GRCh38)
Location 20:23990358-23990380
Sequence GCTGAGGCCCAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171292514_1171292521 30 Left 1171292514 20:23990358-23990380 CCTTCACATTTCTGGGCCTCAGC No data
Right 1171292521 20:23990411-23990433 ACCAGAGATCCCAGACCTCCCGG No data
1171292514_1171292515 -8 Left 1171292514 20:23990358-23990380 CCTTCACATTTCTGGGCCTCAGC No data
Right 1171292515 20:23990373-23990395 GCCTCAGCCACAGCTGCAGCAGG No data
1171292514_1171292518 2 Left 1171292514 20:23990358-23990380 CCTTCACATTTCTGGGCCTCAGC No data
Right 1171292518 20:23990383-23990405 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171292514 Original CRISPR GCTGAGGCCCAGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr