ID: 1171292515

View in Genome Browser
Species Human (GRCh38)
Location 20:23990373-23990395
Sequence GCCTCAGCCACAGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171292508_1171292515 26 Left 1171292508 20:23990324-23990346 CCACGTTGGGGTCACTACTAGAG 0: 1
1: 8
2: 0
3: 5
4: 44
Right 1171292515 20:23990373-23990395 GCCTCAGCCACAGCTGCAGCAGG No data
1171292513_1171292515 -7 Left 1171292513 20:23990357-23990379 CCCTTCACATTTCTGGGCCTCAG No data
Right 1171292515 20:23990373-23990395 GCCTCAGCCACAGCTGCAGCAGG No data
1171292507_1171292515 27 Left 1171292507 20:23990323-23990345 CCCACGTTGGGGTCACTACTAGA 0: 1
1: 8
2: 0
3: 19
4: 34
Right 1171292515 20:23990373-23990395 GCCTCAGCCACAGCTGCAGCAGG No data
1171292514_1171292515 -8 Left 1171292514 20:23990358-23990380 CCTTCACATTTCTGGGCCTCAGC No data
Right 1171292515 20:23990373-23990395 GCCTCAGCCACAGCTGCAGCAGG No data
1171292506_1171292515 28 Left 1171292506 20:23990322-23990344 CCCCACGTTGGGGTCACTACTAG 0: 1
1: 8
2: 0
3: 20
4: 52
Right 1171292515 20:23990373-23990395 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171292515 Original CRISPR GCCTCAGCCACAGCTGCAGC AGG Intergenic
No off target data available for this crispr