ID: 1171292518

View in Genome Browser
Species Human (GRCh38)
Location 20:23990383-23990405
Sequence CAGCTGCAGCAGGTGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171292514_1171292518 2 Left 1171292514 20:23990358-23990380 CCTTCACATTTCTGGGCCTCAGC No data
Right 1171292518 20:23990383-23990405 CAGCTGCAGCAGGTGCCCAGAGG No data
1171292513_1171292518 3 Left 1171292513 20:23990357-23990379 CCCTTCACATTTCTGGGCCTCAG No data
Right 1171292518 20:23990383-23990405 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171292518 Original CRISPR CAGCTGCAGCAGGTGCCCAG AGG Intergenic
No off target data available for this crispr