ID: 1171292521

View in Genome Browser
Species Human (GRCh38)
Location 20:23990411-23990433
Sequence ACCAGAGATCCCAGACCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171292514_1171292521 30 Left 1171292514 20:23990358-23990380 CCTTCACATTTCTGGGCCTCAGC No data
Right 1171292521 20:23990411-23990433 ACCAGAGATCCCAGACCTCCCGG No data
1171292519_1171292521 -10 Left 1171292519 20:23990398-23990420 CCCAGAGGTCAGAACCAGAGATC No data
Right 1171292521 20:23990411-23990433 ACCAGAGATCCCAGACCTCCCGG No data
1171292517_1171292521 8 Left 1171292517 20:23990380-23990402 CCACAGCTGCAGCAGGTGCCCAG No data
Right 1171292521 20:23990411-23990433 ACCAGAGATCCCAGACCTCCCGG No data
1171292516_1171292521 14 Left 1171292516 20:23990374-23990396 CCTCAGCCACAGCTGCAGCAGGT No data
Right 1171292521 20:23990411-23990433 ACCAGAGATCCCAGACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171292521 Original CRISPR ACCAGAGATCCCAGACCTCC CGG Intergenic
No off target data available for this crispr