ID: 1171294349

View in Genome Browser
Species Human (GRCh38)
Location 20:24004601-24004623
Sequence CAGTGGATAAGGAGATAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171294349_1171294356 17 Left 1171294349 20:24004601-24004623 CCCTGTTATCTCCTTATCCACTG No data
Right 1171294356 20:24004641-24004663 GAATACCGCCTCGCCTGAGCAGG No data
1171294349_1171294359 25 Left 1171294349 20:24004601-24004623 CCCTGTTATCTCCTTATCCACTG No data
Right 1171294359 20:24004649-24004671 CCTCGCCTGAGCAGGCCCTTTGG No data
1171294349_1171294353 -5 Left 1171294349 20:24004601-24004623 CCCTGTTATCTCCTTATCCACTG No data
Right 1171294353 20:24004619-24004641 CACTGCAGAAAAGAATCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171294349 Original CRISPR CAGTGGATAAGGAGATAACA GGG (reversed) Intergenic
No off target data available for this crispr