ID: 1171294516

View in Genome Browser
Species Human (GRCh38)
Location 20:24005739-24005761
Sequence CTTTCTTACAGCACGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171294504_1171294516 27 Left 1171294504 20:24005689-24005711 CCAGGTTTTGGTTTCTCTCCACA No data
Right 1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG No data
1171294502_1171294516 29 Left 1171294502 20:24005687-24005709 CCCCAGGTTTTGGTTTCTCTCCA No data
Right 1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG No data
1171294513_1171294516 -7 Left 1171294513 20:24005723-24005745 CCAAGGTCTGCCTGGGCTTTCTT No data
Right 1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG No data
1171294512_1171294516 -1 Left 1171294512 20:24005717-24005739 CCTTCTCCAAGGTCTGCCTGGGC No data
Right 1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG No data
1171294503_1171294516 28 Left 1171294503 20:24005688-24005710 CCCAGGTTTTGGTTTCTCTCCAC No data
Right 1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG No data
1171294509_1171294516 9 Left 1171294509 20:24005707-24005729 CCACACGGGGCCTTCTCCAAGGT No data
Right 1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171294516 Original CRISPR CTTTCTTACAGCACGGTGTC TGG Intergenic
No off target data available for this crispr