ID: 1171295298

View in Genome Browser
Species Human (GRCh38)
Location 20:24012049-24012071
Sequence GGTAGGACACCCCATGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171295296_1171295298 -5 Left 1171295296 20:24012031-24012053 CCATGCACTGAGAGACAAGGTAG No data
Right 1171295298 20:24012049-24012071 GGTAGGACACCCCATGAGAGTGG No data
1171295294_1171295298 22 Left 1171295294 20:24012004-24012026 CCTGGAAAAATGATGTGCACATA No data
Right 1171295298 20:24012049-24012071 GGTAGGACACCCCATGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171295298 Original CRISPR GGTAGGACACCCCATGAGAG TGG Intergenic
No off target data available for this crispr