ID: 1171296800

View in Genome Browser
Species Human (GRCh38)
Location 20:24024133-24024155
Sequence ATGCAGTGATTGAAGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171296798_1171296800 22 Left 1171296798 20:24024088-24024110 CCAATAAACTGCTGCCGTATTTT No data
Right 1171296800 20:24024133-24024155 ATGCAGTGATTGAAGAAATATGG No data
1171296799_1171296800 8 Left 1171296799 20:24024102-24024124 CCGTATTTTATTATCGCAAGAGA No data
Right 1171296800 20:24024133-24024155 ATGCAGTGATTGAAGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171296800 Original CRISPR ATGCAGTGATTGAAGAAATA TGG Intergenic
No off target data available for this crispr