ID: 1171299430

View in Genome Browser
Species Human (GRCh38)
Location 20:24047170-24047192
Sequence TTCCATCTTGAGATAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171299430_1171299431 29 Left 1171299430 20:24047170-24047192 CCTTCATCTATCTCAAGATGGAA No data
Right 1171299431 20:24047222-24047244 ATTGCAGTTTTGAGTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171299430 Original CRISPR TTCCATCTTGAGATAGATGA AGG (reversed) Intergenic
No off target data available for this crispr