ID: 1171299933

View in Genome Browser
Species Human (GRCh38)
Location 20:24051343-24051365
Sequence CCACCACCTGTCTCATCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171299931_1171299933 -4 Left 1171299931 20:24051324-24051346 CCGGAATTCAAGAATTGAACCAC No data
Right 1171299933 20:24051343-24051365 CCACCACCTGTCTCATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171299933 Original CRISPR CCACCACCTGTCTCATCCTC AGG Intergenic
No off target data available for this crispr