ID: 1171302101

View in Genome Browser
Species Human (GRCh38)
Location 20:24072102-24072124
Sequence CAAAATAAACAGATGAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171302101_1171302102 9 Left 1171302101 20:24072102-24072124 CCAAGATTCATCTGTTTATTTTG No data
Right 1171302102 20:24072134-24072156 TTTTTTCAGTAAACTCCTTTTGG No data
1171302101_1171302104 27 Left 1171302101 20:24072102-24072124 CCAAGATTCATCTGTTTATTTTG No data
Right 1171302104 20:24072152-24072174 TTTGGATTACTACAGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171302101 Original CRISPR CAAAATAAACAGATGAATCT TGG (reversed) Intergenic
No off target data available for this crispr