ID: 1171306411

View in Genome Browser
Species Human (GRCh38)
Location 20:24110518-24110540
Sequence CAATACAAGGAGAGCTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306411_1171306421 25 Left 1171306411 20:24110518-24110540 CCAGACCAGCTCTCCTTGTATTG No data
Right 1171306421 20:24110566-24110588 AAAGCAGATAAAGAAAGGGAAGG No data
1171306411_1171306418 20 Left 1171306411 20:24110518-24110540 CCAGACCAGCTCTCCTTGTATTG No data
Right 1171306418 20:24110561-24110583 TGCCAAAAGCAGATAAAGAAAGG No data
1171306411_1171306419 21 Left 1171306411 20:24110518-24110540 CCAGACCAGCTCTCCTTGTATTG No data
Right 1171306419 20:24110562-24110584 GCCAAAAGCAGATAAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306411 Original CRISPR CAATACAAGGAGAGCTGGTC TGG (reversed) Intergenic
No off target data available for this crispr