ID: 1171306616

View in Genome Browser
Species Human (GRCh38)
Location 20:24112515-24112537
Sequence GGGGAAGGGAAGGGGTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306616_1171306627 5 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306627 20:24112543-24112565 GGACTCTCTTCACCAGCAGGTGG No data
1171306616_1171306626 2 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306616_1171306631 28 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306616_1171306629 26 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306629 20:24112564-24112586 GGTGTCCATCCCATGCTCACAGG No data
1171306616_1171306630 27 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306616 Original CRISPR GGGGAAGGGAAGGGGTGAAA TGG (reversed) Intergenic
No off target data available for this crispr