ID: 1171306619

View in Genome Browser
Species Human (GRCh38)
Location 20:24112524-24112546
Sequence GTCCTGTGTGGGGAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306619_1171306627 -4 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306627 20:24112543-24112565 GGACTCTCTTCACCAGCAGGTGG No data
1171306619_1171306626 -7 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306619_1171306629 17 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306629 20:24112564-24112586 GGTGTCCATCCCATGCTCACAGG No data
1171306619_1171306630 18 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG No data
1171306619_1171306631 19 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306619 Original CRISPR GTCCTGTGTGGGGAAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr