ID: 1171306621

View in Genome Browser
Species Human (GRCh38)
Location 20:24112529-24112551
Sequence AGAGAGTCCTGTGTGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306621_1171306636 27 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306636 20:24112579-24112601 CTCACAGGGGAACCACCTGTGGG No data
1171306621_1171306629 12 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306629 20:24112564-24112586 GGTGTCCATCCCATGCTCACAGG No data
1171306621_1171306635 26 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306635 20:24112578-24112600 GCTCACAGGGGAACCACCTGTGG No data
1171306621_1171306631 14 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306621_1171306637 28 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data
1171306621_1171306630 13 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306630 20:24112565-24112587 GTGTCCATCCCATGCTCACAGGG No data
1171306621_1171306627 -9 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306627 20:24112543-24112565 GGACTCTCTTCACCAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306621 Original CRISPR AGAGAGTCCTGTGTGGGGAA GGG (reversed) Intergenic
No off target data available for this crispr