ID: 1171306626

View in Genome Browser
Species Human (GRCh38)
Location 20:24112540-24112562
Sequence ACAGGACTCTCTTCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306614_1171306626 14 Left 1171306614 20:24112503-24112525 CCATTATCTGACCCATTTCACCC No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306619_1171306626 -7 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306618_1171306626 -6 Left 1171306618 20:24112523-24112545 CCCCTTCCCTTCCCCACACAGGA No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306616_1171306626 2 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306620_1171306626 -8 Left 1171306620 20:24112525-24112547 CCTTCCCTTCCCCACACAGGACT No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data
1171306615_1171306626 3 Left 1171306615 20:24112514-24112536 CCCATTTCACCCCTTCCCTTCCC No data
Right 1171306626 20:24112540-24112562 ACAGGACTCTCTTCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306626 Original CRISPR ACAGGACTCTCTTCACCAGC AGG Intergenic
No off target data available for this crispr