ID: 1171306631

View in Genome Browser
Species Human (GRCh38)
Location 20:24112566-24112588
Sequence TGTCCATCCCATGCTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306621_1171306631 14 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306625_1171306631 7 Left 1171306625 20:24112536-24112558 CCACACAGGACTCTCTTCACCAG No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306619_1171306631 19 Left 1171306619 20:24112524-24112546 CCCTTCCCTTCCCCACACAGGAC No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306622_1171306631 13 Left 1171306622 20:24112530-24112552 CCTTCCCCACACAGGACTCTCTT No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306616_1171306631 28 Left 1171306616 20:24112515-24112537 CCATTTCACCCCTTCCCTTCCCC No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306623_1171306631 9 Left 1171306623 20:24112534-24112556 CCCCACACAGGACTCTCTTCACC No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306624_1171306631 8 Left 1171306624 20:24112535-24112557 CCCACACAGGACTCTCTTCACCA No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306618_1171306631 20 Left 1171306618 20:24112523-24112545 CCCCTTCCCTTCCCCACACAGGA No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306615_1171306631 29 Left 1171306615 20:24112514-24112536 CCCATTTCACCCCTTCCCTTCCC No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data
1171306620_1171306631 18 Left 1171306620 20:24112525-24112547 CCTTCCCTTCCCCACACAGGACT No data
Right 1171306631 20:24112566-24112588 TGTCCATCCCATGCTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306631 Original CRISPR TGTCCATCCCATGCTCACAG GGG Intergenic
No off target data available for this crispr