ID: 1171306637

View in Genome Browser
Species Human (GRCh38)
Location 20:24112580-24112602
Sequence TCACAGGGGAACCACCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171306625_1171306637 21 Left 1171306625 20:24112536-24112558 CCACACAGGACTCTCTTCACCAG No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data
1171306623_1171306637 23 Left 1171306623 20:24112534-24112556 CCCCACACAGGACTCTCTTCACC No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data
1171306622_1171306637 27 Left 1171306622 20:24112530-24112552 CCTTCCCCACACAGGACTCTCTT No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data
1171306628_1171306637 2 Left 1171306628 20:24112555-24112577 CCAGCAGGTGGTGTCCATCCCAT No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data
1171306621_1171306637 28 Left 1171306621 20:24112529-24112551 CCCTTCCCCACACAGGACTCTCT No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data
1171306624_1171306637 22 Left 1171306624 20:24112535-24112557 CCCACACAGGACTCTCTTCACCA No data
Right 1171306637 20:24112580-24112602 TCACAGGGGAACCACCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171306637 Original CRISPR TCACAGGGGAACCACCTGTG GGG Intergenic
No off target data available for this crispr