ID: 1171311841

View in Genome Browser
Species Human (GRCh38)
Location 20:24150989-24151011
Sequence CTGGAGGCAGAGTTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171311841_1171311848 -6 Left 1171311841 20:24150989-24151011 CCAGCCTCAAACTCTGCCTCCAG No data
Right 1171311848 20:24151006-24151028 CTCCAGGAGGCAGGGCATGCAGG No data
1171311841_1171311851 16 Left 1171311841 20:24150989-24151011 CCAGCCTCAAACTCTGCCTCCAG No data
Right 1171311851 20:24151028-24151050 GACTCCCACAGAGAGAGGCCTGG No data
1171311841_1171311850 11 Left 1171311841 20:24150989-24151011 CCAGCCTCAAACTCTGCCTCCAG No data
Right 1171311850 20:24151023-24151045 TGCAGGACTCCCACAGAGAGAGG No data
1171311841_1171311854 28 Left 1171311841 20:24150989-24151011 CCAGCCTCAAACTCTGCCTCCAG No data
Right 1171311854 20:24151040-24151062 GAGAGGCCTGGCCTTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171311841 Original CRISPR CTGGAGGCAGAGTTTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr