ID: 1171314470

View in Genome Browser
Species Human (GRCh38)
Location 20:24177009-24177031
Sequence AAGTCTCCATAGCACCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171314468_1171314470 12 Left 1171314468 20:24176974-24176996 CCTGACTCAGTGCTAAGTACCTC No data
Right 1171314470 20:24177009-24177031 AAGTCTCCATAGCACCACTATGG No data
1171314469_1171314470 -7 Left 1171314469 20:24176993-24177015 CCTCATCTGTCACTTAAAGTCTC No data
Right 1171314470 20:24177009-24177031 AAGTCTCCATAGCACCACTATGG No data
1171314467_1171314470 20 Left 1171314467 20:24176966-24176988 CCATAACACCTGACTCAGTGCTA No data
Right 1171314470 20:24177009-24177031 AAGTCTCCATAGCACCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171314470 Original CRISPR AAGTCTCCATAGCACCACTA TGG Intergenic
No off target data available for this crispr