ID: 1171325005

View in Genome Browser
Species Human (GRCh38)
Location 20:24283433-24283455
Sequence ATTTGCATGTAGTTGAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325005_1171325013 6 Left 1171325005 20:24283433-24283455 CCTACTTTCAACTACATGCAAAT No data
Right 1171325013 20:24283462-24283484 GCAGGTCAATACAAATTAAGGGG No data
1171325005_1171325011 4 Left 1171325005 20:24283433-24283455 CCTACTTTCAACTACATGCAAAT No data
Right 1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG No data
1171325005_1171325014 10 Left 1171325005 20:24283433-24283455 CCTACTTTCAACTACATGCAAAT No data
Right 1171325014 20:24283466-24283488 GTCAATACAAATTAAGGGGCAGG No data
1171325005_1171325012 5 Left 1171325005 20:24283433-24283455 CCTACTTTCAACTACATGCAAAT No data
Right 1171325012 20:24283461-24283483 GGCAGGTCAATACAAATTAAGGG No data
1171325005_1171325015 29 Left 1171325005 20:24283433-24283455 CCTACTTTCAACTACATGCAAAT No data
Right 1171325015 20:24283485-24283507 CAGGCTATTTAGAACTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325005 Original CRISPR ATTTGCATGTAGTTGAAAGT AGG (reversed) Intergenic
No off target data available for this crispr