ID: 1171325011

View in Genome Browser
Species Human (GRCh38)
Location 20:24283460-24283482
Sequence GGGCAGGTCAATACAAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325005_1171325011 4 Left 1171325005 20:24283433-24283455 CCTACTTTCAACTACATGCAAAT No data
Right 1171325011 20:24283460-24283482 GGGCAGGTCAATACAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325011 Original CRISPR GGGCAGGTCAATACAAATTA AGG Intergenic
No off target data available for this crispr