ID: 1171325062

View in Genome Browser
Species Human (GRCh38)
Location 20:24283931-24283953
Sequence ATGTCTTTATAGCAGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325062_1171325064 -10 Left 1171325062 20:24283931-24283953 CCCTCACACTGCTATAAAGACAT No data
Right 1171325064 20:24283944-24283966 ATAAAGACATACCTGAGACTAGG 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
1171325062_1171325067 10 Left 1171325062 20:24283931-24283953 CCCTCACACTGCTATAAAGACAT No data
Right 1171325067 20:24283964-24283986 AGGTAATTTATAAAGAAAGGAGG 0: 17
1: 504
2: 5208
3: 10483
4: 9028
1171325062_1171325066 7 Left 1171325062 20:24283931-24283953 CCCTCACACTGCTATAAAGACAT No data
Right 1171325066 20:24283961-24283983 ACTAGGTAATTTATAAAGAAAGG 0: 23
1: 317
2: 626
3: 687
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325062 Original CRISPR ATGTCTTTATAGCAGTGTGA GGG (reversed) Intergenic
No off target data available for this crispr