ID: 1171325064

View in Genome Browser
Species Human (GRCh38)
Location 20:24283944-24283966
Sequence ATAAAGACATACCTGAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39818
Summary {0: 2779, 1: 6067, 2: 10377, 3: 11010, 4: 9585}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325062_1171325064 -10 Left 1171325062 20:24283931-24283953 CCCTCACACTGCTATAAAGACAT No data
Right 1171325064 20:24283944-24283966 ATAAAGACATACCTGAGACTAGG 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
1171325061_1171325064 -7 Left 1171325061 20:24283928-24283950 CCACCCTCACACTGCTATAAAGA No data
Right 1171325064 20:24283944-24283966 ATAAAGACATACCTGAGACTAGG 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325064 Original CRISPR ATAAAGACATACCTGAGACT AGG Intergenic
Too many off-targets to display for this crispr