ID: 1171325066

View in Genome Browser
Species Human (GRCh38)
Location 20:24283961-24283983
Sequence ACTAGGTAATTTATAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2478
Summary {0: 23, 1: 317, 2: 626, 3: 687, 4: 825}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325061_1171325066 10 Left 1171325061 20:24283928-24283950 CCACCCTCACACTGCTATAAAGA No data
Right 1171325066 20:24283961-24283983 ACTAGGTAATTTATAAAGAAAGG 0: 23
1: 317
2: 626
3: 687
4: 825
1171325063_1171325066 6 Left 1171325063 20:24283932-24283954 CCTCACACTGCTATAAAGACATA No data
Right 1171325066 20:24283961-24283983 ACTAGGTAATTTATAAAGAAAGG 0: 23
1: 317
2: 626
3: 687
4: 825
1171325062_1171325066 7 Left 1171325062 20:24283931-24283953 CCCTCACACTGCTATAAAGACAT No data
Right 1171325066 20:24283961-24283983 ACTAGGTAATTTATAAAGAAAGG 0: 23
1: 317
2: 626
3: 687
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325066 Original CRISPR ACTAGGTAATTTATAAAGAA AGG Intergenic
Too many off-targets to display for this crispr