ID: 1171325067

View in Genome Browser
Species Human (GRCh38)
Location 20:24283964-24283986
Sequence AGGTAATTTATAAAGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25240
Summary {0: 17, 1: 504, 2: 5208, 3: 10483, 4: 9028}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325063_1171325067 9 Left 1171325063 20:24283932-24283954 CCTCACACTGCTATAAAGACATA No data
Right 1171325067 20:24283964-24283986 AGGTAATTTATAAAGAAAGGAGG 0: 17
1: 504
2: 5208
3: 10483
4: 9028
1171325062_1171325067 10 Left 1171325062 20:24283931-24283953 CCCTCACACTGCTATAAAGACAT No data
Right 1171325067 20:24283964-24283986 AGGTAATTTATAAAGAAAGGAGG 0: 17
1: 504
2: 5208
3: 10483
4: 9028
1171325061_1171325067 13 Left 1171325061 20:24283928-24283950 CCACCCTCACACTGCTATAAAGA No data
Right 1171325067 20:24283964-24283986 AGGTAATTTATAAAGAAAGGAGG 0: 17
1: 504
2: 5208
3: 10483
4: 9028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325067 Original CRISPR AGGTAATTTATAAAGAAAGG AGG Intergenic
Too many off-targets to display for this crispr