ID: 1171325320

View in Genome Browser
Species Human (GRCh38)
Location 20:24286250-24286272
Sequence CCCCCCATCTAATTAACCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171325318_1171325320 0 Left 1171325318 20:24286227-24286249 CCTATCTTATCTCAGTATGTGGA No data
Right 1171325320 20:24286250-24286272 CCCCCCATCTAATTAACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171325320 Original CRISPR CCCCCCATCTAATTAACCTA CGG Intergenic
No off target data available for this crispr