ID: 1171326455

View in Genome Browser
Species Human (GRCh38)
Location 20:24297823-24297845
Sequence CATTGTGAGGGGTGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171326445_1171326455 -4 Left 1171326445 20:24297804-24297826 CCCACCCAAGCCAGGGCAGCATT No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data
1171326447_1171326455 -8 Left 1171326447 20:24297808-24297830 CCCAAGCCAGGGCAGCATTGTGA No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data
1171326440_1171326455 12 Left 1171326440 20:24297788-24297810 CCTGCTGTAGCCCATGCCCACCC No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data
1171326448_1171326455 -9 Left 1171326448 20:24297809-24297831 CCAAGCCAGGGCAGCATTGTGAG No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data
1171326444_1171326455 1 Left 1171326444 20:24297799-24297821 CCATGCCCACCCAAGCCAGGGCA No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data
1171326446_1171326455 -5 Left 1171326446 20:24297805-24297827 CCACCCAAGCCAGGGCAGCATTG No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data
1171326443_1171326455 2 Left 1171326443 20:24297798-24297820 CCCATGCCCACCCAAGCCAGGGC No data
Right 1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171326455 Original CRISPR CATTGTGAGGGGTGGGAATG AGG Intergenic
No off target data available for this crispr