ID: 1171332644

View in Genome Browser
Species Human (GRCh38)
Location 20:24354748-24354770
Sequence TATTATGTTAGATCAGATAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171332643_1171332644 28 Left 1171332643 20:24354697-24354719 CCAAGTGTTAAGGACTTTTTGTT No data
Right 1171332644 20:24354748-24354770 TATTATGTTAGATCAGATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171332644 Original CRISPR TATTATGTTAGATCAGATAA CGG Intergenic
No off target data available for this crispr