ID: 1171333018

View in Genome Browser
Species Human (GRCh38)
Location 20:24357933-24357955
Sequence GCTCCCCTTCCCTGAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171333013_1171333018 30 Left 1171333013 20:24357880-24357902 CCAGGCTCCTTGGAAAGAAATTC No data
Right 1171333018 20:24357933-24357955 GCTCCCCTTCCCTGAGGCCCAGG No data
1171333015_1171333018 23 Left 1171333015 20:24357887-24357909 CCTTGGAAAGAAATTCTGGTCAA No data
Right 1171333018 20:24357933-24357955 GCTCCCCTTCCCTGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171333018 Original CRISPR GCTCCCCTTCCCTGAGGCCC AGG Intergenic
No off target data available for this crispr