ID: 1171333389

View in Genome Browser
Species Human (GRCh38)
Location 20:24360994-24361016
Sequence CAACCTATTCCCCTTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171333386_1171333389 -5 Left 1171333386 20:24360976-24360998 CCAAGAACCCACTGAGCACAACC No data
Right 1171333389 20:24360994-24361016 CAACCTATTCCCCTTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171333389 Original CRISPR CAACCTATTCCCCTTGAAGC TGG Intergenic
No off target data available for this crispr