ID: 1171339920

View in Genome Browser
Species Human (GRCh38)
Location 20:24419817-24419839
Sequence CAGACCTAGTAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171339913_1171339920 15 Left 1171339913 20:24419779-24419801 CCGAGCAGAAATGCATGTGAAGG No data
Right 1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171339920 Original CRISPR CAGACCTAGTAGAAGGAGGC AGG Intergenic
No off target data available for this crispr