ID: 1171340524

View in Genome Browser
Species Human (GRCh38)
Location 20:24423545-24423567
Sequence CGTCCTGATGTTCCTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171340521_1171340524 14 Left 1171340521 20:24423508-24423530 CCACCTCAGGAGCGCTGTGACTG No data
Right 1171340524 20:24423545-24423567 CGTCCTGATGTTCCTAGAGAAGG No data
1171340519_1171340524 26 Left 1171340519 20:24423496-24423518 CCTGCAATGCCTCCACCTCAGGA No data
Right 1171340524 20:24423545-24423567 CGTCCTGATGTTCCTAGAGAAGG No data
1171340520_1171340524 17 Left 1171340520 20:24423505-24423527 CCTCCACCTCAGGAGCGCTGTGA No data
Right 1171340524 20:24423545-24423567 CGTCCTGATGTTCCTAGAGAAGG No data
1171340522_1171340524 11 Left 1171340522 20:24423511-24423533 CCTCAGGAGCGCTGTGACTGCTC No data
Right 1171340524 20:24423545-24423567 CGTCCTGATGTTCCTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171340524 Original CRISPR CGTCCTGATGTTCCTAGAGA AGG Intergenic