ID: 1171340527

View in Genome Browser
Species Human (GRCh38)
Location 20:24423562-24423584
Sequence AGAAGGAAGCTGTCACTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171340522_1171340527 28 Left 1171340522 20:24423511-24423533 CCTCAGGAGCGCTGTGACTGCTC No data
Right 1171340527 20:24423562-24423584 AGAAGGAAGCTGTCACTCTGAGG No data
1171340525_1171340527 -9 Left 1171340525 20:24423548-24423570 CCTGATGTTCCTAGAGAAGGAAG No data
Right 1171340527 20:24423562-24423584 AGAAGGAAGCTGTCACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171340527 Original CRISPR AGAAGGAAGCTGTCACTCTG AGG Intergenic