ID: 1171345267

View in Genome Browser
Species Human (GRCh38)
Location 20:24461287-24461309
Sequence AGTATGAAGGCGGGTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171345267_1171345275 -1 Left 1171345267 20:24461287-24461309 CCCCCCACACCCGCCTTCATACT No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345267_1171345276 0 Left 1171345267 20:24461287-24461309 CCCCCCACACCCGCCTTCATACT No data
Right 1171345276 20:24461310-24461332 CGCACATGCACCTGCACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171345267 Original CRISPR AGTATGAAGGCGGGTGTGGG GGG (reversed) Intergenic
No off target data available for this crispr