ID: 1171345272

View in Genome Browser
Species Human (GRCh38)
Location 20:24461296-24461318
Sequence GCATGTGCGAGTATGAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171345272_1171345275 -10 Left 1171345272 20:24461296-24461318 CCCGCCTTCATACTCGCACATGC No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345272_1171345276 -9 Left 1171345272 20:24461296-24461318 CCCGCCTTCATACTCGCACATGC No data
Right 1171345276 20:24461310-24461332 CGCACATGCACCTGCACACTGGG No data
1171345272_1171345278 28 Left 1171345272 20:24461296-24461318 CCCGCCTTCATACTCGCACATGC No data
Right 1171345278 20:24461347-24461369 AACACATGTAGTCCTTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171345272 Original CRISPR GCATGTGCGAGTATGAAGGC GGG (reversed) Intergenic