ID: 1171345273

View in Genome Browser
Species Human (GRCh38)
Location 20:24461297-24461319
Sequence TGCATGTGCGAGTATGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171345273_1171345276 -10 Left 1171345273 20:24461297-24461319 CCGCCTTCATACTCGCACATGCA No data
Right 1171345276 20:24461310-24461332 CGCACATGCACCTGCACACTGGG No data
1171345273_1171345278 27 Left 1171345273 20:24461297-24461319 CCGCCTTCATACTCGCACATGCA No data
Right 1171345278 20:24461347-24461369 AACACATGTAGTCCTTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171345273 Original CRISPR TGCATGTGCGAGTATGAAGG CGG (reversed) Intergenic
No off target data available for this crispr