ID: 1171345275

View in Genome Browser
Species Human (GRCh38)
Location 20:24461309-24461331
Sequence TCGCACATGCACCTGCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171345268_1171345275 -2 Left 1171345268 20:24461288-24461310 CCCCCACACCCGCCTTCATACTC No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345270_1171345275 -4 Left 1171345270 20:24461290-24461312 CCCACACCCGCCTTCATACTCGC No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345269_1171345275 -3 Left 1171345269 20:24461289-24461311 CCCCACACCCGCCTTCATACTCG No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345272_1171345275 -10 Left 1171345272 20:24461296-24461318 CCCGCCTTCATACTCGCACATGC No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345271_1171345275 -5 Left 1171345271 20:24461291-24461313 CCACACCCGCCTTCATACTCGCA No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data
1171345267_1171345275 -1 Left 1171345267 20:24461287-24461309 CCCCCCACACCCGCCTTCATACT No data
Right 1171345275 20:24461309-24461331 TCGCACATGCACCTGCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171345275 Original CRISPR TCGCACATGCACCTGCACAC TGG Intergenic
No off target data available for this crispr