ID: 1171345278

View in Genome Browser
Species Human (GRCh38)
Location 20:24461347-24461369
Sequence AACACATGTAGTCCTTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171345277_1171345278 4 Left 1171345277 20:24461320-24461342 CCTGCACACTGGGACACACACTT No data
Right 1171345278 20:24461347-24461369 AACACATGTAGTCCTTACACTGG No data
1171345273_1171345278 27 Left 1171345273 20:24461297-24461319 CCGCCTTCATACTCGCACATGCA No data
Right 1171345278 20:24461347-24461369 AACACATGTAGTCCTTACACTGG No data
1171345272_1171345278 28 Left 1171345272 20:24461296-24461318 CCCGCCTTCATACTCGCACATGC No data
Right 1171345278 20:24461347-24461369 AACACATGTAGTCCTTACACTGG No data
1171345274_1171345278 24 Left 1171345274 20:24461300-24461322 CCTTCATACTCGCACATGCACCT No data
Right 1171345278 20:24461347-24461369 AACACATGTAGTCCTTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171345278 Original CRISPR AACACATGTAGTCCTTACAC TGG Intergenic
No off target data available for this crispr