ID: 1171346777

View in Genome Browser
Species Human (GRCh38)
Location 20:24471129-24471151
Sequence GCTGCTCACCCCACAGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346777_1171346779 -3 Left 1171346777 20:24471129-24471151 CCTGCGCCTGTGGGGTGAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1171346779 20:24471149-24471171 AGCCTCATAGCCCCCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 260
1171346777_1171346789 30 Left 1171346777 20:24471129-24471151 CCTGCGCCTGTGGGGTGAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346777_1171346786 16 Left 1171346777 20:24471129-24471151 CCTGCGCCTGTGGGGTGAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1171346786 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346777 Original CRISPR GCTGCTCACCCCACAGGCGC AGG (reversed) Intronic
900171301 1:1270409-1270431 GCTGCTCACCCCACACACCCAGG + Intronic
900623874 1:3599353-3599375 GCTGCTCACCCCACAGCCCGAGG - Intronic
901018760 1:6245622-6245644 GCCGCGCACCCCGCAAGCGCAGG + Intergenic
901883949 1:12209681-12209703 GCTGCTCATCCCTCAGGAGGAGG - Intergenic
902361147 1:15943282-15943304 GCTGCCCACGCCCCAGGCTCTGG - Intronic
902404449 1:16175152-16175174 GCGGCCCACCCCTCAGGCCCAGG - Intergenic
904343743 1:29854847-29854869 GCTACTCACCCCATAGTCACTGG - Intergenic
905808785 1:40896810-40896832 CCTGCTCAGCCCACAAGCCCAGG - Intergenic
905943256 1:41880810-41880832 GATGCTCGCCCCACAGATGCAGG - Intronic
906642435 1:47449522-47449544 GCAGGGCACCCCACAGGAGCTGG + Intergenic
912977367 1:114342685-114342707 GCTGCTGGCACCACTGGCGCTGG - Intergenic
913077829 1:115356269-115356291 GATGCTCCACCCACAGGCTCAGG + Intergenic
915251774 1:154595133-154595155 GCTGCTGATCCCACAGGAGGCGG - Intronic
918577446 1:186079872-186079894 GCTGCTCACCTCCCAGGTGCAGG + Intronic
919910208 1:202106496-202106518 GCTGTTTACCCCCCAGGAGCAGG + Intergenic
920734947 1:208525120-208525142 GCTGCTCATTCCACAGTTGCTGG - Intergenic
922236475 1:223726317-223726339 GCTGCCCTCCCCCCAGGCGCAGG - Intronic
922745003 1:228038583-228038605 CCTGCTCACGCCACAGCTGCTGG - Intronic
922752916 1:228079284-228079306 GCTGGTCACACCACAGGACCTGG - Intergenic
922754383 1:228086985-228087007 GCTTCTCACACCACATGAGCAGG - Intronic
923748416 1:236724650-236724672 GCTGCTCACCCCCCAGTCTTTGG + Intronic
924946052 1:248847697-248847719 GCTGCTCTTCCACCAGGCGCGGG + Exonic
1063386496 10:5619557-5619579 GCTGCCGACCACACAGGGGCAGG - Intergenic
1067314785 10:45151277-45151299 GATGCTCTCCCCACAGCCTCAGG - Intergenic
1069457200 10:68562110-68562132 GCGGCTCACCCCGCCGGCCCAGG - Intronic
1069561657 10:69435183-69435205 GCTGCCCACCCCACCAACGCTGG - Intergenic
1069833897 10:71296771-71296793 GCTGCACACCACACTGGCGGAGG + Intronic
1073103387 10:101018778-101018800 GCTGCTCCCTCCACAGCCTCTGG - Intronic
1076472073 10:130725847-130725869 GCTGCTCACGGCAGAGGTGCAGG + Intergenic
1076714715 10:132357928-132357950 TCTGCGCACCCCACAGGCCCTGG + Intronic
1076765803 10:132632370-132632392 GCTACTCACACCACAGGCGTTGG - Intronic
1076907686 10:133371645-133371667 GCTGTCCACCCAGCAGGCGCAGG - Intronic
1077013770 11:391175-391197 GCTGCCCCAGCCACAGGCGCGGG + Intergenic
1078478916 11:11659236-11659258 GCTGCTCTCTGCACAGGCGGTGG - Intergenic
1078548958 11:12267379-12267401 GTTGCTCAGCCCAAAGGCCCTGG + Intergenic
1079141211 11:17810974-17810996 GCTGCTCTCCCAAGAGGCTCCGG - Intronic
1081483031 11:43506617-43506639 GCCGGTTACCCCACAGGCTCTGG - Intergenic
1081986244 11:47306400-47306422 GCTGCACAGGCCACAGGGGCTGG + Intronic
1083541609 11:63515488-63515510 GCTGCTCAGCCCCCAGGGGAAGG - Intronic
1084045142 11:66563960-66563982 GGTGTTCACGCCACAGGCCCCGG + Exonic
1084068116 11:66717184-66717206 GCTGCCCAGCCCACAGGGGAGGG + Intronic
1084087984 11:66863461-66863483 GATTCTCACCCCAGAGGGGCGGG + Intronic
1084486392 11:69450629-69450651 GAGGCTCAACCCACAGGCACCGG - Intergenic
1085218258 11:74850985-74851007 GCTGCTCACTCCACAGTGCCTGG - Intronic
1085416671 11:76322912-76322934 GCTCATCACCCCACAGGTTCAGG - Intergenic
1090403070 11:126461262-126461284 GCTGCTCACCACACAGGAGGAGG + Intronic
1092833608 12:12467876-12467898 GCTGCCCACACCACAAGTGCAGG - Exonic
1096474561 12:51900361-51900383 GCGGCTCAGCACGCAGGCGCAGG + Intergenic
1096844130 12:54396126-54396148 GCTCCTCACCCCCCTGGCTCTGG + Exonic
1098951592 12:76645366-76645388 GCAGCTCATCCCCCAGGCACAGG - Intergenic
1101881826 12:108630888-108630910 GCTGATCAGGCCACAGGCCCAGG + Intronic
1102025813 12:109713919-109713941 GCGCCGCGCCCCACAGGCGCCGG - Intergenic
1103318014 12:120072750-120072772 GGTCCTTACCCCACAGGAGCTGG + Intronic
1103513927 12:121494509-121494531 GCTGTTCACCCTACAGGAGGTGG + Intronic
1103897130 12:124280100-124280122 GTTGCTCTCCCCACAGCTGCCGG + Intronic
1104462128 12:128964451-128964473 GCTGCTCACCCCCAAGGGGACGG - Intronic
1104575354 12:129961800-129961822 GCTCTTCTCCCCACAGACGCAGG + Intergenic
1104655144 12:130568793-130568815 TCTGCCCACCTCACAGGAGCTGG - Intronic
1112050548 13:95641387-95641409 GCTGCTCACCAAGCAGGCGGGGG - Exonic
1112086228 13:96034776-96034798 GCTGCCCACCCCACTGCAGCTGG + Intronic
1112381095 13:98891053-98891075 GCAGCTCACACCGCAGGCACAGG - Intronic
1113231207 13:108215550-108215572 GCTGCTCGCCGCGCAGGCGCAGG + Intronic
1113696799 13:112352378-112352400 GGTCCTCACCCCCCAGGTGCTGG - Intergenic
1114337981 14:21712784-21712806 GCTGCTCATCCTCCAGGTGCGGG + Intergenic
1114616098 14:24069232-24069254 CCTCCTGACCCCACAGGTGCTGG + Exonic
1118982143 14:70725520-70725542 GGTGCTCACCACTCAGGTGCTGG - Intronic
1119183148 14:72617814-72617836 GCTGCTCACAACAAAGGCCCAGG - Intergenic
1119544942 14:75464798-75464820 GGTCCACACCCCACAGGCCCTGG + Intronic
1119672100 14:76527720-76527742 CATGCTCAGCCCACAGGCGTGGG + Intergenic
1119704211 14:76774021-76774043 GCTGCCTACCCCAGGGGCGCAGG - Intronic
1122122796 14:99563457-99563479 GCTCCTGAGCCCACAGGCACAGG + Intronic
1122910011 14:104822989-104823011 GCTGCCCTCCCCACAGGGGGTGG + Intergenic
1123029498 14:105445036-105445058 GCAGGTCACCCCAGAGGGGCTGG + Intronic
1202840300 14_GL000009v2_random:115012-115034 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1202909683 14_GL000194v1_random:105209-105231 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1124380536 15:29161315-29161337 GCAGCTCACCACACATGTGCAGG + Intronic
1124577517 15:30922960-30922982 GCTGCCTAGCCCACAGGCACAGG - Intronic
1125720522 15:41843026-41843048 GCTTCTCACCTCACAGACACAGG + Intronic
1129342071 15:74892645-74892667 CCTGGCCACCCCACAGGAGCTGG + Exonic
1131651139 15:94400761-94400783 GCTGCTCACCCCAAAGGAAGTGG - Intronic
1132271283 15:100528285-100528307 CTTGCTCACCCCACAGTGGCAGG - Intronic
1132580642 16:683228-683250 GCTCATAACCCCACAGGAGCTGG - Exonic
1132605929 16:793745-793767 GCAGCACATCCCACAGGCCCAGG - Intronic
1132651349 16:1022697-1022719 GCGGCTCACCCACCAGGCCCAGG - Intergenic
1132729562 16:1354829-1354851 ACGCCTGACCCCACAGGCGCAGG - Intronic
1133160836 16:3910518-3910540 CCTGCTCACCCTAGAGGGGCAGG - Intergenic
1137609861 16:49811011-49811033 GCTGTTCAGCCCAGAGGGGCAGG + Intronic
1139391680 16:66609517-66609539 GCTGCTCACCCCAGCGGCTTTGG - Exonic
1140963316 16:79938813-79938835 GTTGCTCAGCCCATAGGCGTTGG + Intergenic
1141557668 16:84846601-84846623 GCAGTTCACCCCACAGGAACGGG - Intronic
1141824595 16:86470279-86470301 GCTGTTCTCCCCACCGGGGCTGG - Intergenic
1142121976 16:88390970-88390992 GCTGCCCACACCACAGGCCCGGG + Intergenic
1144088806 17:11834920-11834942 CCTGCTCATCCCTCAGGGGCTGG + Intronic
1144574421 17:16419994-16420016 ACTGCACACCCCTCAGGCCCAGG - Intronic
1144712988 17:17414574-17414596 GCTGCCAACCCCACAGCCCCAGG - Intergenic
1145126257 17:20302351-20302373 GCAGCTCAGCCCACAGGAGCCGG - Intronic
1148356657 17:46979626-46979648 GCTGCCCACTCCACTGGCCCCGG + Intronic
1148655259 17:49278398-49278420 GCTGCTCACACTGCAGGAGCTGG + Intergenic
1148899591 17:50866088-50866110 GCTGCTCCCCGCCCAGCCGCGGG - Exonic
1150337486 17:64341368-64341390 CCTGCTCCCCACACAGGCCCTGG - Intronic
1150631630 17:66884469-66884491 GATGCTCAGCCCAGAGGCCCAGG - Intronic
1151766961 17:76137721-76137743 GCTGCCCACCCCGGAGGAGCAGG - Exonic
1151827166 17:76529937-76529959 GCTGCTGACCACACTGGCCCCGG - Intronic
1152495561 17:80668991-80669013 GCTTCTCACACCACAGAGGCTGG + Intronic
1152561188 17:81079557-81079579 GCAGCTCACCCCACCAGCCCAGG - Intronic
1152750434 17:82060087-82060109 GCTGCCCTCCCCTCAGGCCCAGG - Exonic
1152768473 17:82153483-82153505 GCTGTTGACCCCACAGGCAAAGG + Intronic
1157711605 18:49853499-49853521 ACTGCTCTCCCCAGAGGCCCAGG - Exonic
1158236626 18:55322684-55322706 GCTGCTCCCCTCGCTGGCGCTGG + Intronic
1159102666 18:63972643-63972665 CCCGCCCACCCCACAGGCCCCGG + Intronic
1160740530 19:683443-683465 GCTGCCCATCCCACAGCCGTGGG - Intergenic
1160803345 19:980302-980324 GCTGCTCTCCCCACTGGCATAGG + Intergenic
1160868692 19:1267271-1267293 GCAGCTGACCCCAGAGGCACAGG + Intronic
1160878195 19:1307565-1307587 GCTGCTTCCGCCACAGGCCCGGG + Intergenic
1161686633 19:5705986-5706008 GCACCTCACCCCACAGGTGGAGG - Exonic
1166768384 19:45265783-45265805 TCTGCTTACCCCACATGCCCCGG - Intronic
1167513495 19:49909454-49909476 GCTGCCCAGCCCAAAGCCGCTGG + Exonic
1202632754 1_KI270706v1_random:15539-15561 GCTGCCCACCCCACTGCAGCTGG - Intergenic
925007114 2:452233-452255 GCTGCTCACCTGACAGGAGGTGG + Intergenic
927955912 2:27207249-27207271 CCTGCTCACCTCATAGGCACTGG + Exonic
930200215 2:48545573-48545595 TCTCCTCACCAGACAGGCGCTGG + Intronic
931005711 2:57848954-57848976 GCTGCCCACCCCACTGCAGCTGG - Intergenic
931671574 2:64653384-64653406 GCGGCTCAGCCCGCAGGCGCCGG + Intronic
937446999 2:121966759-121966781 GCCCCTCACCTCACAGGCCCAGG - Intergenic
938027075 2:127958916-127958938 GCGGCTCACCCCACAGCTTCAGG - Intronic
945268089 2:207911048-207911070 GCTGTTCCCCACACAGGCACTGG - Intronic
948983221 2:241505571-241505593 GCTGCTCTCCACACAGGGCCTGG + Intronic
1170932755 20:20783575-20783597 TCTGCTGATCCCACAGACGCAGG - Intergenic
1171346777 20:24471129-24471151 GCTGCTCACCCCACAGGCGCAGG - Intronic
1173384411 20:42574606-42574628 GCTACTCAGCCCACTGGAGCAGG + Intronic
1174397308 20:50255218-50255240 ACTCCTCACACCTCAGGCGCAGG - Intergenic
1175714525 20:61246709-61246731 GCTGCTCACCCCTCTTGCTCTGG - Intergenic
1175978828 20:62727012-62727034 GCTGTGCACCCCACAAGCTCTGG - Intronic
1176198464 20:63848507-63848529 GCTGCTCAGCCCCCAGGAGCTGG - Intergenic
1176288894 21:5033948-5033970 CCTGCACACCCCACGGGGGCTGG - Intronic
1176430316 21:6571382-6571404 GCTGCACTCCACACAGGAGCTGG + Intergenic
1176599029 21:8775141-8775163 GCTGCCCACCCCACTGCAGCTGG - Intergenic
1176629031 21:9119917-9119939 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1176644967 21:9341419-9341441 GCTGCCCACCCCACTGCAGCTGG - Intergenic
1179705710 21:43178844-43178866 GCTGCACTCCACACAGGAGCTGG + Intergenic
1179785731 21:43728709-43728731 GCTGCTCACACCACCGGCCGAGG + Intronic
1180367985 22:11957815-11957837 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1181527098 22:23496221-23496243 GCTGGTGACCCCACAGGGGCTGG + Intergenic
1183370242 22:37427846-37427868 GCTGCTCACCCCGCGGGATCCGG + Intergenic
1183515982 22:38266356-38266378 TCTGCCCACCTCACAGGCTCTGG - Intronic
1183743237 22:39679651-39679673 CCTGCCCACCCCACAGCCCCGGG + Intronic
1184380602 22:44142942-44142964 GCTGCTGCCCCCACAGGGGCGGG - Intronic
1184683654 22:46086195-46086217 GCGGCTCACCCACCAGGTGCTGG - Intronic
1184968234 22:47996772-47996794 GGTGCTGACCCCAGAGGCGAAGG + Intergenic
1185191209 22:49437736-49437758 GCTACTCTCACCCCAGGCGCTGG - Intronic
950483403 3:13258821-13258843 CCTCCCCACCCCACAGGGGCTGG + Intergenic
950643011 3:14360509-14360531 GGTGCCCACCCCCCAGGCCCTGG + Intergenic
950679906 3:14577950-14577972 CCTGTTCACCCCACAGGCCCTGG - Intergenic
953745966 3:45574299-45574321 GCGGTTCATCCCACAGACGCTGG + Intronic
954259127 3:49426074-49426096 GCTGCCCACCCCACAGGCCTTGG + Intronic
955325735 3:58008363-58008385 GCGGCTCAGCGCGCAGGCGCGGG + Intergenic
956360179 3:68438982-68439004 GCTGCTCCCATCACAGGCCCAGG - Intronic
960097091 3:113699140-113699162 GGTGCGCACCCCGCGGGCGCTGG - Intergenic
960883134 3:122366299-122366321 CCTGCTCATGCCACAGGCACTGG - Intronic
961484356 3:127206814-127206836 GCTGCCCAGCCCCCAGGCCCAGG - Intergenic
961509484 3:127392159-127392181 GGTTCCCACCCCACAGGCACCGG + Intergenic
964075065 3:152683785-152683807 GCTGCCCACCCCACTGCAGCTGG - Intergenic
965505982 3:169515334-169515356 GCTGCTGGCCCCACAGGAGTTGG - Intronic
966862797 3:184239825-184239847 GCTGCTCCCCACACAGGCCCCGG - Exonic
1202741924 3_GL000221v1_random:63649-63671 GCTGCCCACCCCACTGCAGCTGG + Intergenic
968491775 4:894003-894025 CCTGCTCTCCCCGCAGGCCCTGG - Exonic
968491795 4:894063-894085 CCTGCTCTCCCCGCAGGCCCAGG - Intronic
968491870 4:894299-894321 CCTGCACTCCCCACAGGCCCAGG - Intronic
968661466 4:1800482-1800504 CCTGCTTACCCCACTGGCCCAGG - Intronic
968765963 4:2469319-2469341 GCGGCTCCCCCAAGAGGCGCGGG - Intronic
969193653 4:5543780-5543802 GGTGCCAACCCCACAGGGGCTGG - Intronic
969613321 4:8238711-8238733 GCTGCTCACTGCTCAGGGGCTGG + Intronic
969675216 4:8610721-8610743 GCTGCCCCACCCACAGGTGCAGG + Intronic
971018978 4:22515793-22515815 GCCGCTCGCCCCGCAGGCCCCGG - Exonic
984638508 4:182140366-182140388 CCAGCTCACCCCTCAGGCTCAGG - Intergenic
985217828 4:187672195-187672217 GGTGCTGACTCCACAGGCGGGGG - Intergenic
985521299 5:374982-375004 TCTCCTCACCCCACAGTCCCTGG - Intronic
988436351 5:31179533-31179555 GGTGCTCTCTCCACAGGAGCTGG + Intergenic
988789199 5:34591822-34591844 GCTGCTCTGGCCACAGGAGCAGG - Intergenic
988831722 5:34994327-34994349 TCTGCTCTCCCCACAGGCAGTGG - Intergenic
992663693 5:78985267-78985289 GCTGGTGGCGCCACAGGCGCTGG - Exonic
997979552 5:138460260-138460282 GGGGCTCACACCACAGGGGCTGG + Intergenic
999286431 5:150396879-150396901 GCTGGGCACCCCACGGGGGCGGG + Intronic
1001933229 5:175687579-175687601 GCAGCTCACCCCACAGTCAGGGG + Intergenic
1001933703 5:175690171-175690193 GCAGCTCACCCCACAGTCAGGGG + Intergenic
1002341532 5:178519343-178519365 TCTGCACACCCCACAGCAGCTGG - Intronic
1002399236 5:178982007-178982029 GCTGCCAGCCCCTCAGGCGCGGG - Intronic
1002451632 5:179322270-179322292 GCTCCTCTCCCCACCTGCGCTGG - Intronic
1002500009 5:179642290-179642312 TCTGCGCACCCCACAGATGCTGG - Intronic
1004246089 6:13977443-13977465 GCTGCTCACCCCCAAGAGGCTGG + Exonic
1006643966 6:35503685-35503707 GCTGCTCCCCTTACAGGGGCTGG - Intronic
1006802613 6:36768816-36768838 GCTGCTCACCCCACAGCCGAAGG - Intronic
1006882866 6:37354598-37354620 GCTTCTCGCCCCACAGGCCGCGG - Intronic
1007340986 6:41191524-41191546 GCTGCTCACCCCACAGACACTGG - Exonic
1007721433 6:43887628-43887650 GCTGCACAGCCCACAGCTGCAGG - Intergenic
1010141881 6:72622137-72622159 GCTGCCCCCGCCGCAGGCGCTGG + Exonic
1015854212 6:137606143-137606165 GCTGGTCACACCACTGGGGCAGG + Intergenic
1018827660 6:167421762-167421784 GCTGCTCCCCCCACAGCCTGCGG + Intergenic
1019407671 7:892211-892233 GCTTCTGCCCGCACAGGCGCCGG - Intronic
1019617801 7:1974150-1974172 CCTGCTCAGCCCCCAGGAGCTGG + Intronic
1020009719 7:4801470-4801492 GCTGCTCAGCCCCCAGCAGCTGG - Intronic
1021842060 7:24728777-24728799 GATGCTCAGCCCACAGCCGGGGG + Intronic
1023661822 7:42478202-42478224 CCTGCCCAGCCCACAGCCGCTGG + Intergenic
1023699917 7:42882801-42882823 GCTGCCCACCCCACTGCAGCTGG - Intergenic
1023938596 7:44756315-44756337 TCTGCCCACCCCTCAGGCCCTGG + Intronic
1029578531 7:101419961-101419983 GTTGCTCTCTCCACAGGCACTGG + Exonic
1033147513 7:138883975-138883997 GCTGCTCACCACAGAGCCCCAGG + Intronic
1035694494 8:1584738-1584760 GCAGCTCACCCCACACCCGGCGG + Intronic
1036597768 8:10229562-10229584 TCTGCCCTCCCCACATGCGCAGG - Intronic
1037690356 8:21176694-21176716 GCTGCTGACCTCACAGGAGGCGG + Intergenic
1038656534 8:29457688-29457710 GCTTATCACCCCACAAGGGCAGG - Intergenic
1041167376 8:55102779-55102801 GCTGCTCCCTGCCCAGGCGCAGG - Exonic
1044848452 8:96404972-96404994 GCAGCTCACACCACAAGTGCAGG - Intergenic
1045352328 8:101353102-101353124 GCTCCTCTCCCAACAGGCTCTGG - Intergenic
1049164520 8:141117838-141117860 GCTGCCCACCCCACAGGGCAGGG - Intronic
1049190742 8:141286033-141286055 GTTACTGACCCCACAGGCGTGGG + Intronic
1049379848 8:142306558-142306580 GCTGCTCACCCCACACCCAGGGG + Intronic
1049399510 8:142418688-142418710 CCTGCTCACCCCTCAGCCCCAGG + Intergenic
1049554059 8:143273558-143273580 GCTGGTCACCCCACCGCAGCTGG + Intronic
1049748988 8:144274719-144274741 GCTGCCCACCCGGCAGGCGGCGG + Intronic
1049847043 8:144807867-144807889 GCTGCCCACACCGCAGGCACCGG - Exonic
1053391610 9:37740246-37740268 GCTGCTGGCCCCGCAGGTGCTGG - Exonic
1056928887 9:90858240-90858262 CCTGCTCACCCCAGAGGCCAAGG + Intronic
1057414636 9:94850152-94850174 GGTGCTCACCCCGCAGGCTGGGG - Intronic
1062176123 9:135164067-135164089 GCTGCTCACCCCCAAGGTCCCGG - Intergenic
1062215312 9:135385913-135385935 GCAGCTCAGCCCTCAGACGCAGG - Intergenic
1062449739 9:136610453-136610475 GCAGCCCACCCCACGGGCGCTGG + Intergenic
1062582994 9:137236588-137236610 GCTGCTTCCCCCACCTGCGCAGG - Intergenic
1203691511 Un_GL000214v1:47201-47223 GCTGCCCACCCCACTGCAGCTGG - Intergenic
1203751874 Un_GL000218v1:87598-87620 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1203710554 Un_KI270742v1:93573-93595 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1203644784 Un_KI270751v1:56990-57012 GCTGCCCACCCCACTGCAGCTGG + Intergenic
1187388670 X:18871641-18871663 GCTGTCCTCCCCACAGGCCCAGG - Intergenic
1189287186 X:39860184-39860206 GGTGCTCACGCCACAGACTCTGG + Intergenic
1195051117 X:101097984-101098006 GCTGCTCTCCTCACAGGCCCAGG + Intergenic
1198520947 X:137451624-137451646 GCTACTCCCACCACAGGCCCGGG - Intergenic
1200012494 X:153129282-153129304 GCTGCTCACACTGCAAGCGCTGG + Intergenic
1200027105 X:153270637-153270659 GCTGCTCACACTGCAAGCGCTGG - Intergenic
1200090256 X:153632698-153632720 GCTGGCCACCCCCCAGGGGCTGG - Intergenic
1201165531 Y:11205218-11205240 GCTGCCCACCCCACTGCAGCTGG + Intergenic