ID: 1171346778

View in Genome Browser
Species Human (GRCh38)
Location 20:24471135-24471157
Sequence TATGAGGCTGCTCACCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346778_1171346779 -9 Left 1171346778 20:24471135-24471157 CCTGTGGGGTGAGCAGCCTCATA 0: 1
1: 0
2: 3
3: 16
4: 112
Right 1171346779 20:24471149-24471171 AGCCTCATAGCCCCCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 260
1171346778_1171346790 25 Left 1171346778 20:24471135-24471157 CCTGTGGGGTGAGCAGCCTCATA 0: 1
1: 0
2: 3
3: 16
4: 112
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346778_1171346786 10 Left 1171346778 20:24471135-24471157 CCTGTGGGGTGAGCAGCCTCATA 0: 1
1: 0
2: 3
3: 16
4: 112
Right 1171346786 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1171346778_1171346789 24 Left 1171346778 20:24471135-24471157 CCTGTGGGGTGAGCAGCCTCATA 0: 1
1: 0
2: 3
3: 16
4: 112
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346778 Original CRISPR TATGAGGCTGCTCACCCCAC AGG (reversed) Intronic
900488410 1:2934449-2934471 GATGGCCCTGCTCACCCCACAGG - Intergenic
900882314 1:5390991-5391013 TTTGAGGCTGCCCAGCCCAGAGG - Intergenic
902169219 1:14597620-14597642 AATGAGGCTGCCCACCCTTCAGG - Intergenic
902381158 1:16052972-16052994 AATGGGGCTGCTTACCCCAGTGG + Intronic
902398831 1:16146492-16146514 GAGGAGCCTGCTCGCCCCACTGG + Intronic
903668031 1:25019583-25019605 TATGAGTGTGCTCACCCCACAGG - Intergenic
903904320 1:26673023-26673045 TATGAGCCACCACACCCCACCGG + Intergenic
904160766 1:28520563-28520585 GATGAGTCTGCTCACCTCAAAGG + Intronic
906058899 1:42935780-42935802 TATGAGGCTGCCCACCTTACAGG + Intronic
906318645 1:44803633-44803655 CATGAGGCCGCTCACCAAACCGG - Exonic
909130337 1:71727884-71727906 TACAAGGCTTCGCACCCCACTGG - Intronic
912204190 1:107492587-107492609 TATGTGGCTGCTTAGCCCACTGG + Intergenic
912498048 1:110103901-110103923 TATGAGGCTGCTGGTCCAACAGG + Intergenic
913084964 1:115428377-115428399 CATGAGGCTACTCAACCCAAGGG + Intergenic
919791099 1:201291524-201291546 CATGATGCTGCTCTCCCCATGGG - Intronic
921613001 1:217234204-217234226 TAGGAGGCTGCAGATCCCACTGG - Intergenic
922420924 1:225460805-225460827 TATGACACTGCCCACCCCACAGG + Intergenic
1067049270 10:43002707-43002729 AATGAGGCTGCACCTCCCACAGG - Intergenic
1071012545 10:80954942-80954964 TATGAGGCCACTTTCCCCACTGG + Intergenic
1071926330 10:90414329-90414351 TATGAGGCCAGTCTCCCCACTGG - Intergenic
1072708796 10:97701982-97702004 GAAGAAGCTGCTCACACCACAGG - Intergenic
1076494304 10:130886808-130886830 AATGAGGCTGCTTACCCCCCAGG + Intergenic
1077369742 11:2175926-2175948 TGTGAGGCTGCTCCGCCCACAGG + Intergenic
1078891243 11:15560707-15560729 GAGGATGCTGCTCAGCCCACTGG + Intergenic
1078924815 11:15865088-15865110 TCTGAGTCTACTCTCCCCACAGG + Intergenic
1081774264 11:45666552-45666574 ACTGAGGCTGCCCACCCCAGTGG + Intergenic
1083476552 11:62919153-62919175 TACGAGGCAGCTCTCCCCTCGGG + Intronic
1083842276 11:65311295-65311317 TCTCAGGCTTCTAACCCCACAGG - Intergenic
1085255398 11:75169705-75169727 CATGAGGCTGCCCAGCCCAAAGG - Exonic
1085534662 11:77210868-77210890 AATGGGGCTGCTCATCTCACTGG + Intronic
1090403068 11:126461256-126461278 CATGTGGCTGCTCACCACACAGG + Intronic
1090986781 11:131774196-131774218 TATGAGGCTTCTTACCCCTCAGG + Intronic
1101803268 12:108041403-108041425 TATGTGCCAACTCACCCCACTGG + Intergenic
1104814481 12:131637863-131637885 CAGGAGGCTGCTCACCCCATGGG + Intergenic
1106785921 13:33108188-33108210 TATGAGGCTGGTCACCTTTCAGG - Intronic
1108257455 13:48624290-48624312 CATGAGGCTGCATACCCAACGGG - Intergenic
1113947475 13:114052301-114052323 TACGAGGCCCTTCACCCCACAGG - Intronic
1114214276 14:20644253-20644275 GATGAGACTGGTCACCCCAAAGG + Intergenic
1114483687 14:23050464-23050486 TATGTGTCTGTCCACCCCACTGG - Intronic
1116266248 14:42694258-42694280 TATGTTGCTGCTATCCCCACAGG - Intergenic
1118388025 14:65272859-65272881 TATGAGGCTGCTGGCACCAGAGG + Intergenic
1118443931 14:65835215-65835237 TCAGAGGCTGCACAGCCCACAGG - Intergenic
1125767364 15:42144579-42144601 AACGAGGCTCCTCACCCCACAGG - Exonic
1126546983 15:49884815-49884837 TATGCGGCTGCTCATCTGACAGG - Intronic
1127956129 15:63855143-63855165 TGTGATTCTGCTCAGCCCACTGG + Intergenic
1129449029 15:75639525-75639547 TATGAGGGTGCTCTCCTCAAGGG - Exonic
1133418203 16:5623161-5623183 CATGAGACTGCTCACTTCACTGG - Intergenic
1134505846 16:14806243-14806265 TTAGAGGCTGCTTTCCCCACTGG + Intronic
1134574733 16:15322696-15322718 TTAGAGGCTGCTTTCCCCACTGG - Intergenic
1134727710 16:16433770-16433792 TTAGAGGCTGCTTTCCCCACTGG + Intergenic
1134939726 16:18278057-18278079 TTAGAGGCTGCTTTCCCCACTGG - Intergenic
1136365329 16:29806763-29806785 CATGAGGCCGCCCACCCCCCGGG - Exonic
1138944159 16:61827727-61827749 TATGAAGCTGCTTACCTCAATGG - Intronic
1139848975 16:69939477-69939499 TATGAAGCTGCTACACCCACTGG - Intronic
1143261109 17:5598952-5598974 TTTGAGGGTGCTCAGCACACGGG - Intronic
1147657400 17:42098559-42098581 AATGAGCCCGCGCACCCCACCGG - Intergenic
1148345674 17:46902153-46902175 AAGGAGGCTGCTCACCTCATTGG - Intergenic
1152108152 17:78342461-78342483 TCTGAGCCTGCACAGCCCACGGG + Intergenic
1152887216 17:82859523-82859545 TGTGTGTCTGCTCACCCAACAGG - Intronic
1155237328 18:23833839-23833861 TCTGCGGCTGCGCATCCCACAGG + Exonic
1160976777 19:1796665-1796687 TCTGAGGCCGCTCAGCCCCCGGG - Intronic
1162464050 19:10830224-10830246 AAGGAGGCTGCTGCCCCCACGGG - Exonic
1163672836 19:18638478-18638500 CAGGAGGCTGGTCACCCCTCTGG - Intronic
1166065708 19:40357414-40357436 CATGAGGCAGATCACACCACAGG - Intronic
1166942497 19:46375283-46375305 TGGGATGCTGCTCACCCCACAGG + Intronic
1167587003 19:50380889-50380911 GATGGGGCTGCTCACAGCACAGG + Intronic
1167660820 19:50794943-50794965 TATGAGGCTGCCATCCCCCCAGG + Exonic
925007112 2:452227-452249 AATGCGGCTGCTCACCTGACAGG + Intergenic
928451690 2:31383660-31383682 TATCAGGGTGGTCTCCCCACTGG - Intronic
932387460 2:71349260-71349282 TATGAGGCTCATCATCCCACCGG - Exonic
934808357 2:97258597-97258619 TATGAGCCAGTTCACCCAACCGG + Intronic
934829152 2:97498589-97498611 TATGAGCCAGTTCACCCAACCGG - Intronic
935174815 2:100640463-100640485 TGAGAGGCTGCTCACCCCACTGG + Intergenic
937293751 2:120797671-120797693 TCTGAGGCAGCTCAGCCCCCTGG - Intronic
943797995 2:192022238-192022260 TATGAAGCTGCACACCCACCTGG - Intronic
945418728 2:209607748-209607770 CATGTGGCTGCCTACCCCACTGG + Intronic
945722083 2:213429655-213429677 CATGAGTCTGCTCACCCACCTGG + Intronic
947739414 2:232478390-232478412 TTGCTGGCTGCTCACCCCACAGG + Intergenic
947740467 2:232482589-232482611 CAGGTGGCTGCTCCCCCCACAGG - Exonic
1171346778 20:24471135-24471157 TATGAGGCTGCTCACCCCACAGG - Intronic
1171446360 20:25207264-25207286 TGTGGGCCTGCTGACCCCACCGG - Exonic
1172916066 20:38444685-38444707 GTTGAGGCTGCACACCCCTCAGG - Intergenic
1173394176 20:42662578-42662600 TATAATGCTGCTTACCTCACTGG - Intronic
1176408779 21:6436531-6436553 CATGGGGCTGCTCACCCATCGGG - Intergenic
1176931425 21:14815444-14815466 TATGAGGATGCTCTCCTCACTGG + Intergenic
1178896271 21:36561304-36561326 CATGTGGCTGCCCACCCCAGTGG - Intronic
1179577640 21:42317863-42317885 TCACAGGGTGCTCACCCCACAGG + Intergenic
1179684272 21:43044853-43044875 CATGGGGCTGCTCACCCATCGGG - Intergenic
1180105948 21:45618141-45618163 GATGAGGCTGCTGAGCCCTCAGG - Intergenic
1180701706 22:17784889-17784911 TGAGGGGCTGCTCAACCCACAGG - Intergenic
1181040171 22:20188336-20188358 GCTGAGGCTGCCCACACCACAGG - Intergenic
1181468098 22:23121194-23121216 CCTGAGGCTGCTCACTCCTCAGG + Intronic
1183541046 22:38429650-38429672 GAAGAGGCCCCTCACCCCACTGG + Intronic
950025254 3:9815773-9815795 TATGAGGCTTGTCAGCCCCCAGG - Intronic
950185614 3:10943630-10943652 TCTGATGCTGGTCCCCCCACAGG + Intergenic
950366332 3:12487232-12487254 CATGTGGCTGCACACCCCTCAGG - Intronic
953060528 3:39425124-39425146 AATGAGGCTGCTGACTCCAAAGG + Intergenic
954439501 3:50514036-50514058 TCTGAGGCTGCTCACCTCACTGG - Intergenic
962420092 3:135220262-135220284 TCTGCGGATGCTCACCCCGCAGG + Intronic
963011370 3:140773502-140773524 TCTGAGGCTGCTCGCCTCCCTGG + Intergenic
968706481 4:2080650-2080672 CTTGAGGCTGCCCACCCCAGAGG - Intronic
969373484 4:6748475-6748497 TATGAGGCTTTTCACCCAAATGG - Intergenic
976345157 4:83992130-83992152 TATGAGGCTACTTTCCCCACTGG - Intergenic
977514775 4:98007282-98007304 TGTGAGCCTGCTCACCCGCCTGG + Intronic
980905675 4:138946434-138946456 TATGAGGGTGCTCATCCTATAGG - Intergenic
984431267 4:179652220-179652242 GATGAGGCTTCTCAACACACAGG - Intergenic
988975887 5:36515517-36515539 TCTGAGGCTGCACTTCCCACAGG + Intergenic
990567947 5:57048830-57048852 TATTCTGCAGCTCACCCCACTGG - Intergenic
993081969 5:83312454-83312476 TATGATGCTCCTCACACAACAGG - Intronic
997594380 5:135096293-135096315 AAAGAGGCTGCACACGCCACAGG - Intronic
1005387892 6:25304079-25304101 TATGAGCCTGCTGCCCCCACAGG + Intronic
1007976398 6:46105941-46105963 TATGAGAGTGCTCACCACAGAGG + Intergenic
1010767021 6:79787205-79787227 TTAGAGGCTGCTAACCCCAGGGG + Intergenic
1011865150 6:91816301-91816323 CCTGAGGGTGCTCACCCCTCTGG + Intergenic
1015413970 6:132927741-132927763 GATGAGGCTGTTCACTGCACTGG - Intergenic
1017343622 6:153355299-153355321 TATGAGGCCAGTCTCCCCACTGG - Intergenic
1017902356 6:158729369-158729391 TAAGAGGCTGCACACAGCACTGG - Intronic
1028798813 7:94937298-94937320 TATGAGGCTGTTCCCTTCACTGG + Intronic
1029032896 7:97487659-97487681 CATGAGACTGCTCAGGCCACTGG + Intergenic
1049213288 8:141396435-141396457 CCTGGAGCTGCTCACCCCACTGG - Intronic
1049909422 9:251005-251027 TATAAGTCTGCTCAACTCACTGG - Intronic
1056330134 9:85514323-85514345 CATGAGGCTGCTCACCACTCTGG - Intergenic
1059355717 9:113697942-113697964 TCTGAGGCTGTGCACCACACTGG + Intergenic
1060809702 9:126604472-126604494 TCTGAGGCTGCCCAGCCCACAGG + Intergenic
1186620854 X:11238624-11238646 TTTGAGGCAGCTCATTCCACTGG - Intronic
1190490854 X:50981756-50981778 TATGAGGCCAGTCTCCCCACTGG - Intergenic
1191615898 X:63168916-63168938 TCAGGGGCTGCTCACTCCACAGG - Intergenic
1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG + Intergenic
1196929489 X:120667147-120667169 TATGATGTTGCTAATCCCACAGG - Intergenic
1198997830 X:142595685-142595707 CATGAAGATGCTCACCCCCCAGG + Intergenic
1199601557 X:149544230-149544252 GCTGAGGCAGCTCACCCCAGAGG + Intronic
1199648820 X:149935254-149935276 GCTGAGGCAGCTCACCCCAGAGG - Intronic