ID: 1171346780

View in Genome Browser
Species Human (GRCh38)
Location 20:24471151-24471173
Sequence GGCCGGCTCTGGGGGCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346780_1171346786 -6 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346786 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 60
1171346780_1171346794 23 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346780_1171346792 22 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346780_1171346791 21 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346780_1171346790 9 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346780_1171346795 28 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346780_1171346789 8 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346780 Original CRISPR GGCCGGCTCTGGGGGCTATG AGG (reversed) Intronic
900100899 1:961567-961589 GGGCGGCGCTGGGGGCTCCGTGG + Intronic
900650400 1:3727493-3727515 TGCCGGCACTGGGTGCTCTGTGG + Intronic
901772497 1:11537378-11537400 GGCCCTCTCTGGGGGCTCTGGGG + Exonic
902409625 1:16205457-16205479 GGCCGGGTCTCGGGAGTATGAGG - Intronic
902919591 1:19657957-19657979 GGCCGGCTCTGGCAGCTTTCTGG - Exonic
903344723 1:22677015-22677037 GGCCGCCTCTGGGGGCGCAGGGG - Intergenic
903366547 1:22808915-22808937 GGCCAGCTCTGGGGGCCACGAGG - Intronic
903649533 1:24914383-24914405 GGCCGGCTCTGCGGCCTGTCAGG + Intronic
904521542 1:31099828-31099850 GGCAGGCTCTGGGGCCTCTCAGG - Intergenic
904607383 1:31705212-31705234 GGGGGGCTCTGGGGGCTCTGTGG + Intergenic
905366625 1:37455094-37455116 GGCCAGCACTGAGGGCTCTGGGG + Intergenic
906107708 1:43304778-43304800 GGCTGGGGCTGGGGGCTCTGGGG + Intronic
906534195 1:46542803-46542825 GGCTGGGTCTGTGGGCTCTGTGG - Intergenic
906535778 1:46550325-46550347 GTCCGGCCCTGGGGGCCCTGGGG - Intronic
915441502 1:155948097-155948119 TGCAGGCTCAGGGGGCTCTGGGG + Intronic
922566324 1:226604080-226604102 GGCAAACTCTGGGGGCTGTGTGG - Exonic
924825165 1:247531149-247531171 GGAGGGCTCCGGGGGCTCTGGGG + Exonic
1065025243 10:21534563-21534585 GGCGGGCTCGGGGGGCTGTGTGG + Intronic
1065515625 10:26521588-26521610 GGTTGGCTATAGGGGCTATGTGG - Intronic
1065519223 10:26555205-26555227 GGAAGTCACTGGGGGCTATGAGG - Intronic
1071430024 10:85600053-85600075 GGCCATCTCAGGGGGCAATGAGG + Exonic
1072158818 10:92747779-92747801 GGCAGGGTCTGGGTTCTATGAGG - Intergenic
1073323524 10:102629686-102629708 GGGAGGGTCTGGAGGCTATGGGG - Intronic
1075031160 10:119025613-119025635 GGCCCGGGCTGGGGGCCATGTGG + Intergenic
1075302765 10:121340324-121340346 AGCCGGCTCTGGGAACAATGGGG - Intergenic
1076507651 10:130988330-130988352 GGCCGGCTGTGGGTTCCATGAGG - Intergenic
1077228952 11:1450243-1450265 GGGCGGCTCGGGGGGCGGTGGGG - Intronic
1077332764 11:1990592-1990614 GGCCGGCCCTGGAGGCAAAGAGG - Intergenic
1080386492 11:31813902-31813924 TACCGGCTCTGGGGGCGAAGCGG + Intronic
1083308751 11:61773921-61773943 GCCCGGCTCTGGGGCCTCAGGGG + Intronic
1084463190 11:69307612-69307634 GGCCAGCTCTCGGGGTTGTGGGG + Intronic
1084542657 11:69797244-69797266 GGCCGGCCCTTGGGTCTGTGCGG - Intergenic
1086920442 11:92580778-92580800 GGCCTTCTCTTGGGGATATGTGG + Intronic
1088172938 11:107018208-107018230 AGCCGGCTCGGGGGGCTCCGCGG - Exonic
1089261416 11:117226421-117226443 GGCTGGGCGTGGGGGCTATGGGG - Intronic
1091315742 11:134612726-134612748 TGCAGGCTCTGGGGGCTGTTGGG + Intergenic
1202815747 11_KI270721v1_random:45768-45790 GGCCGGCCCTGGAGGCAAAGAGG - Intergenic
1091747068 12:2999341-2999363 GGCCGGCCCGGTGGGGTATGGGG + Intronic
1096514703 12:52149385-52149407 GGCCTGGCCTGGGGGCTTTGGGG - Intergenic
1101716704 12:107318701-107318723 GGCCGGAGCTGGGCGCAATGGGG - Exonic
1102014228 12:109637316-109637338 GGCCAGCTCTGGGGACAATTAGG - Intergenic
1103400851 12:120641580-120641602 GGCGGGTTCTGGCGGGTATGAGG - Intronic
1103507864 12:121453727-121453749 GGCTGGCTCTGCGGGCTCTAGGG - Intronic
1103583948 12:121937171-121937193 GGCTGCTTCTGGGGGCTGTGAGG + Intronic
1104095117 12:125550114-125550136 TGCAGGCTCTGGGGGCTGTGCGG - Intronic
1104444729 12:128823919-128823941 GGAGGGCTCTGGGGGCGGTGCGG - Exonic
1105344797 13:19561864-19561886 GGCCGGCTCTGGGGCCAGTCTGG - Intergenic
1106416396 13:29549504-29549526 GGCTGGCTCTGGGGTCAATTTGG - Intronic
1107552210 13:41487668-41487690 TCCCAGCTCTGGTGGCTATGGGG - Intergenic
1113916798 13:113878797-113878819 GGCCGTCTGATGGGGCTATGGGG + Intergenic
1113955874 13:114099682-114099704 GGGCTGCTGTGGGGGCTGTGGGG - Intronic
1113955884 13:114099705-114099727 GGGCTGCTGTGGGGGCTGTGGGG - Intronic
1116929752 14:50678396-50678418 GGCTGCCTCTGGGAGCTCTGAGG - Intergenic
1117645108 14:57843366-57843388 GGCAGGCTATGGGGGTAATGAGG + Intronic
1119729185 14:76940283-76940305 AGCCGGCCCTGGGGGAGATGGGG - Intergenic
1119780025 14:77271183-77271205 GGGCGGCTCTGGCGGCTGCGGGG - Exonic
1122019018 14:98821034-98821056 GGGCAGCTCTGGAGGCTTTGGGG - Intergenic
1122662477 14:103306872-103306894 GGGGGGGTCGGGGGGCTATGGGG + Intergenic
1123103106 14:105818943-105818965 GACCGGGTCTGGGGGCACTGGGG + Intergenic
1123735603 15:23180072-23180094 GGGCGGCTCGGGGGGCCACGCGG + Intergenic
1124286319 15:28403055-28403077 GGGCGGCTCGGGGGGCCACGCGG + Intergenic
1124296384 15:28508581-28508603 GGGCGGCTCGGGGGGCCACGCGG - Intergenic
1124624486 15:31300236-31300258 GGCAGGCTCTGGGGCCTGGGTGG - Intergenic
1125714700 15:41812871-41812893 GGCAGGCTCTGGGGTGGATGGGG + Intronic
1128622291 15:69160843-69160865 GGGCGGCTCTGGGGGCTGCGCGG + Intronic
1128704505 15:69828807-69828829 GTCAGGCTATGGGGGCTTTGGGG - Intergenic
1132318502 15:100908320-100908342 GCCCTGCACTGGGGGCTAAGTGG + Intronic
1133046829 16:3092729-3092751 AGCCGGCTCCGGGAGCTCTGCGG - Exonic
1133773306 16:8880310-8880332 GGCCGGGCCTGTGGGTTATGGGG + Intergenic
1133802219 16:9092614-9092636 GGCCGGCTCAGGGCACAATGGGG - Intronic
1133832921 16:9340772-9340794 GTCTGGCTCTGGGGGCTGTCGGG + Intergenic
1136061237 16:27728122-27728144 GGCAGGGTCTGGGCGCTGTGGGG + Intronic
1136610335 16:31362079-31362101 GCCCCGTTCTGGGGGCTGTGGGG + Exonic
1138428119 16:56950175-56950197 GGCCGGCTCTGGAGGTTGTGGGG + Intergenic
1138582858 16:57952943-57952965 GGCCTGCCCTGGGGGCTGTGTGG - Intronic
1138725974 16:59139563-59139585 GGTTGCCTCTGAGGGCTATGAGG + Intergenic
1139547713 16:67657433-67657455 GGAGGGCTCTGTGGGCTGTGGGG - Exonic
1141437658 16:84009628-84009650 GGGCTGCTCATGGGGCTATGCGG - Intergenic
1141614434 16:85202520-85202542 GGCCGGCTCTGGAGAACATGAGG + Intergenic
1142015231 16:87742303-87742325 GTCAGGCTCTGAGTGCTATGTGG - Intronic
1142307782 16:89295215-89295237 TGCAGGCTCTGAGGGCTTTGTGG + Intronic
1142813588 17:2408302-2408324 GGGCGGGGCTGGGGGGTATGGGG + Intronic
1142848407 17:2692899-2692921 GGCGGGCTCTGGGTGCAGTGGGG - Intronic
1143174969 17:4950224-4950246 TGCCGGCTCTGGGGCCAGTGCGG - Intronic
1144495255 17:15741663-15741685 GGTGGGAGCTGGGGGCTATGTGG - Intronic
1144741086 17:17582629-17582651 GGGCAGCTCTGGGGGCAGTGGGG - Intronic
1146917991 17:36690379-36690401 GGCCAGCTCTGGAGGCTCTATGG + Intergenic
1147304457 17:39553694-39553716 GGCAGGCTCTGGGGCCCATTGGG + Intronic
1147994403 17:44353268-44353290 GGACAGCTCTGGGGACTAGGGGG - Exonic
1148095717 17:45051612-45051634 GGCCGGCTCAGCGGGCGAGGCGG + Exonic
1151655173 17:75492459-75492481 GGCTGGGTCTGGGGGAAATGTGG - Exonic
1152231930 17:79118088-79118110 GGCCGGCACTGGGGGCTTCAGGG - Intronic
1154134751 18:11766477-11766499 GGCTGTCTCTGGGGACTCTGGGG - Intronic
1154412826 18:14150569-14150591 GTCTGGCTCTGGGCGATATGAGG - Intergenic
1155176742 18:23307729-23307751 CACGGGCTCTGAGGGCTATGGGG + Intronic
1157762529 18:50275126-50275148 CACCGGCTCTGTGGGCTCTGGGG + Exonic
1159519177 18:69496078-69496100 TGCCTGCTCTGTGGGCTAGGAGG + Intronic
1160804227 19:984705-984727 GCGCGGGTCTGGGGGCTTTGGGG + Intronic
1160865427 19:1253946-1253968 GGGCGCCGCTGGGGGCTGTGGGG - Intronic
1161074922 19:2280890-2280912 GTCGGGCTCGGGGGGCTCTGTGG + Exonic
1162582554 19:11539863-11539885 GGCCGGCGCTGGGGGGGAGGAGG - Intronic
1162969125 19:14169682-14169704 GGCCGGGTTTGGGGACTAAGAGG - Intronic
1163267077 19:16227892-16227914 GGCCTGCTCTGGGGGCTGCCTGG - Intronic
1165881430 19:39046733-39046755 GGCAGACTGTGGGGGCTTTGTGG + Intergenic
1166000062 19:39872470-39872492 GGACGGCTCTGTGGCCTCTGTGG - Exonic
1166250327 19:41565201-41565223 GGCGGGCTCTGAGGGCAAGGGGG - Intronic
1166932239 19:46308430-46308452 GCCCTGCCCTGGGGTCTATGGGG + Intronic
1168013727 19:53554888-53554910 GGTGCGCTCTGGGGGATATGTGG + Intronic
1168685725 19:58347894-58347916 GGCCTGCTCTGGGGCTTCTGGGG + Intronic
926125777 2:10270784-10270806 GGCTGGCACTGAGGGCTCTGCGG - Intergenic
932563374 2:72890980-72891002 GGTTGGCTCTGGGGACGATGGGG + Intronic
934708977 2:96503085-96503107 GACTGGCTCTGGGGGCAAGGAGG + Intronic
936073942 2:109389877-109389899 GGCCGGCCCTGGGAGCTCTTTGG + Intronic
937983661 2:127629015-127629037 GGCTGTGTCTGTGGGCTATGGGG + Intronic
941095892 2:161239015-161239037 GGCCGGCGCTGGGGGCCGCGCGG - Intergenic
944645665 2:201778843-201778865 GGCCCGCTTTGGGTACTATGAGG - Intronic
948580919 2:238986682-238986704 GGCAGGGTCTGGGGGCTCGGCGG + Intergenic
948801811 2:240436478-240436500 GGCCGGCTGTCGGGGCGCTGTGG + Intronic
948854614 2:240724388-240724410 GGGCTGCTCTGTGGGGTATGGGG - Intronic
949000343 2:241609830-241609852 GGCCGGCTCTCTGGCCTGTGCGG + Intronic
1169210806 20:3765355-3765377 TGCTGCCTCTGGGGGCCATGTGG - Intronic
1171346780 20:24471151-24471173 GGCCGGCTCTGGGGGCTATGAGG - Intronic
1172384368 20:34523294-34523316 GGACGGCTCTGGCTGCTGTGGGG - Intronic
1173007430 20:39150989-39151011 GGCCAGCTCTGGGGCCTTTTGGG + Intergenic
1173570401 20:44071987-44072009 GGCCAGCTCTGTGGGCAGTGGGG - Intergenic
1174481182 20:50832644-50832666 GGCCCGTTCTGGAGGCTCTGGGG + Intronic
1175942972 20:62546376-62546398 GCCTGGCCCTGGGGGCTAAGGGG + Intergenic
1176088717 20:63309591-63309613 GGCCGGCTCCTGTGGCTCTGAGG + Intronic
1176122509 20:63460451-63460473 GGCTGTCTCAGGGGGCTGTGGGG - Intronic
1176197568 20:63844467-63844489 CCCTGGGTCTGGGGGCTATGAGG - Intergenic
1176860182 21:14007686-14007708 GTCTGGCTCTGGGCGATATGAGG + Intergenic
1178673994 21:34615243-34615265 GGCCGGCCCTAGGGGCTGGGGGG - Intergenic
1179904626 21:44416015-44416037 GGTTGGCTCTGGGGGTTCTGTGG + Intronic
1180001277 21:44996621-44996643 GGGCTGGTCTGGGGGCTCTGGGG + Intergenic
1180081015 21:45487531-45487553 GGCCGGCTCTGAGGGGTAAGGGG + Intronic
1180736877 22:18024008-18024030 GGCAGGCTCTGGGGAGTGTGTGG + Intronic
1180756421 22:18164995-18165017 GGCCTGCACAGGGGGCAATGGGG - Intronic
1181075348 22:20372439-20372461 GGCCTGCACAGGGGGCAATGGGG + Intronic
1183749897 22:39713949-39713971 GGCTGGCTCTGGGGGAGGTGAGG + Intergenic
1184471430 22:44698323-44698345 GGGTGGCTCTGGTGGCTTTGGGG + Intronic
1184795271 22:46728503-46728525 GGGCGTCTCAGAGGGCTATGAGG + Intronic
1185364858 22:50432804-50432826 GTCTGGCTCTGGGCGATATGAGG + Intronic
952258553 3:31716512-31716534 CCCCGGCCATGGGGGCTATGAGG + Intronic
953492956 3:43365335-43365357 GCCGGGCTCTGGGGGATAGGGGG + Intronic
955916432 3:63912439-63912461 GGCGGGCTCGGGGGGCTGGGCGG + Intronic
960511678 3:118556657-118556679 GGCCTTTTCTGAGGGCTATGAGG - Intergenic
960960502 3:123067345-123067367 GGCGGGCACTGGGTGCTACGCGG + Intronic
961810284 3:129518197-129518219 GGCTGTTTCTGGGGGCTATAAGG - Intronic
961832639 3:129632079-129632101 GGAGGGCTCTGTGGGCTATGGGG + Intergenic
962803767 3:138912568-138912590 GACAGGCTCTTGGGGCTCTGAGG - Intergenic
964253697 3:154750175-154750197 TGCCAGCTGTGGTGGCTATGAGG + Intergenic
966182264 3:177197746-177197768 GGCCCGCTCTGGCGGCACTGGGG + Intergenic
966516774 3:180828758-180828780 GGCCGGCCCTGGGAGCCAAGTGG - Intronic
968859742 4:3157705-3157727 GGCTGGCTCTTGGGGGTATCTGG - Intronic
971382496 4:26111525-26111547 GGCTGGCTTTTGGGGCTTTGGGG + Intergenic
982200624 4:152956885-152956907 TGCCGGCTCTGGGGACTGTCAGG - Intronic
985530588 5:431610-431632 GGCCGCTGCTGGGGGCCATGGGG - Intronic
989103056 5:37838357-37838379 GGCCGGCTTTGACGGCTTTGCGG + Intronic
997444158 5:133929251-133929273 GTCAGGCTCTGGGGCCTGTGTGG - Intergenic
1001407266 5:171484897-171484919 GGCTGACTCTGGGTGCCATGAGG - Intergenic
1001494676 5:172179397-172179419 GGGCTGTTCTGGGGGCTATGGGG + Intronic
1001939216 5:175729014-175729036 GGCTGGTTTTGGGGGCTGTGCGG - Intergenic
1002158736 5:177302803-177302825 AGCAGGCTCTGAGCGCTATGAGG - Exonic
1002901005 6:1409841-1409863 GGGAGGCTCCGGGGGCCATGGGG - Intergenic
1006643086 6:35498293-35498315 GACGGGCTCTGGGGGCGCTGAGG + Exonic
1007065651 6:38987938-38987960 GGCAGGGTGTGGGGGCTGTGAGG - Intronic
1008492618 6:52102151-52102173 GGATGACTCTGGGGACTATGTGG + Intergenic
1009194229 6:60665282-60665304 GGACCACTCTGGGGGCTATGGGG + Intergenic
1019175454 6:170157176-170157198 GCCAGGCTCTGGGGGCCCTGGGG - Intergenic
1023048933 7:36234958-36234980 GGCCTGGGCTGGAGGCTATGGGG - Intronic
1023048974 7:36235083-36235105 GGCCTGGGCTGGAGGCTATGGGG - Intronic
1023646269 7:42318987-42319009 TCCCAGCTGTGGGGGCTATGGGG + Intergenic
1024498315 7:50071941-50071963 GACCAGCTGTGGTGGCTATGGGG + Intronic
1026015727 7:66669344-66669366 GGCAGCCTCTGGGGGCTGTGGGG - Intronic
1026980513 7:74523963-74523985 GGCCGGCCTCGGGGGCTCTGGGG + Intronic
1029473314 7:100767990-100768012 GGCCAGCTCTGTGGGCTGTGTGG + Exonic
1031927490 7:127652102-127652124 GGCGGGCTCTGGGCGCTAATTGG + Intergenic
1032455931 7:132073467-132073489 GGCAGGAGCTGGGGGCCATGAGG + Intergenic
1034264827 7:149775892-149775914 GGCCAGTTCTGGGGGCTGTGGGG - Intergenic
1035284903 7:157799808-157799830 GGCCGGCTGTGGTGCCTCTGAGG - Intronic
1035284914 7:157799840-157799862 GGCCGGCTGTGGTGCCTCTGAGG - Intronic
1035284925 7:157799872-157799894 GGCCGGCTGTGGTGCCTCTGAGG - Intronic
1035284936 7:157799904-157799926 GGCCGGCTGTGGTGCCTCTGAGG - Intronic
1035284947 7:157799936-157799958 GGCCGGCTGTGGTGCCTCTGAGG - Intronic
1035284972 7:157800032-157800054 GGCCGGCTGTGGTGCCTCTGAGG - Intronic
1037959489 8:23085071-23085093 GCCCAGATCTGGGGCCTATGAGG + Intronic
1040628139 8:49175675-49175697 TTCCAGCTCTGGAGGCTATGGGG + Intergenic
1047967991 8:130060930-130060952 GGCCAGTTCTGTGGGCTTTGGGG + Exonic
1048295464 8:133210575-133210597 GGAAGGCTCTGTGGGCGATGTGG - Intronic
1048321898 8:133406520-133406542 GGCAGGCTATGCGGGCTCTGAGG + Intergenic
1049468494 8:142764548-142764570 GCCAGGCTGTGGGGGCTGTGGGG + Exonic
1052588762 9:30464101-30464123 TGCAGGATTTGGGGGCTATGGGG - Intergenic
1054765517 9:69039494-69039516 GGCTGGGGCTGGGGGCTGTGGGG - Intronic
1057777300 9:98021433-98021455 GGCCGGCACTGAGGGCTCTCAGG - Intergenic
1059197118 9:112380444-112380466 GGCCGGCACTGGGGGCGGCGTGG - Intronic
1059948426 9:119437046-119437068 GGTTGGCTCTGGGCCCTATGGGG + Intergenic
1060186437 9:121566799-121566821 AGCCGGCTCTGGGGCCCAGGGGG - Intergenic
1061326735 9:129868847-129868869 GTCCGGCTCTGGGGGCAGAGAGG - Exonic
1062178146 9:135175773-135175795 CCCTGGCTCTGGGGGCTGTGGGG - Intergenic
1062397769 9:136359296-136359318 TGCCAGCCCTGGGGGCTGTGGGG - Exonic
1062468655 9:136692520-136692542 GGCCGGCTCTGGCGCCTACAGGG + Intergenic
1062532784 9:137009180-137009202 GGAGGGCTGTGGGGGCTGTGGGG - Intronic
1062570160 9:137181262-137181284 CGAGGGCTCTGAGGGCTATGGGG - Intronic
1189498222 X:41529095-41529117 GGCCGGCCCTCAGGGCTAGGTGG + Intronic
1192428415 X:71096737-71096759 GGCCGGCTCTGGGAGCCGAGAGG - Exonic
1192504115 X:71670507-71670529 TGCAGGCTATGGGGGCTATAAGG + Intergenic
1192927094 X:75766842-75766864 TCCCAGCTCTGGTGGCTATGCGG + Intergenic
1197096677 X:122604552-122604574 TACCAGCTCTGGTGGCTATGGGG + Intergenic
1200032461 X:153307347-153307369 GGTGGGCCCTGGGGGCTATGTGG + Intergenic
1200120381 X:153787385-153787407 GGCCTGCTCTGAGGGATTTGTGG - Intronic
1200134803 X:153869747-153869769 GGCGAGCCCTGGGGGCTGTGGGG - Intronic
1200210559 X:154345074-154345096 GGCCGGCTCTCCCTGCTATGGGG + Intergenic
1200220293 X:154387018-154387040 GGCCGGCTCTCCCTGCTATGGGG - Intergenic
1200370517 X:155719865-155719887 TCCCGGCTGTGGTGGCTATGGGG + Intergenic