ID: 1171346781

View in Genome Browser
Species Human (GRCh38)
Location 20:24471159-24471181
Sequence GAGAAGTTGGCCGGCTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 428}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346781_1171346795 20 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346781_1171346791 13 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346781_1171346789 0 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346781_1171346794 15 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346781_1171346792 14 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346781_1171346796 26 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346781_1171346790 1 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346781 Original CRISPR GAGAAGTTGGCCGGCTCTGG GGG (reversed) Intronic
900008940 1:88695-88717 GAGATGGGGGCCGGCTCTGCCGG - Intergenic
900008990 1:88912-88934 GAGATGGGGGCCGGCTCTGCTGG - Intergenic
900409213 1:2505225-2505247 GGGAACCTGGGCGGCTCTGGAGG + Exonic
903299902 1:22371308-22371330 AAGAAATTGGCCGGGTGTGGTGG + Intergenic
903753623 1:25645804-25645826 AAGAAGCAGGGCGGCTCTGGTGG - Intronic
904075373 1:27837787-27837809 AAGAAGTTGGCCAGCCATGGTGG + Intronic
904505102 1:30946070-30946092 TAGGAGTTGGCCGGGTGTGGTGG - Intronic
904558219 1:31379485-31379507 TAGGAGTTGGCCGGGTGTGGTGG - Intergenic
904923551 1:34028166-34028188 AAGAAATTAGCCGGCTGTGGTGG + Intronic
905036092 1:34919039-34919061 GGGCAGGTGGGCGGCTCTGGCGG + Intronic
905455613 1:38086037-38086059 GAGCAGCTGGCCAGCTGTGGGGG - Intergenic
907223359 1:52923310-52923332 TAAAATTTGGCCGGGTCTGGTGG + Intronic
907889482 1:58623522-58623544 GAGCAGCCGGCCGGCTCTGCCGG + Intergenic
908709874 1:67003015-67003037 GAGAAGTTGGCAAGCTCAGTAGG + Exonic
910484882 1:87702280-87702302 AAGAAGTAGGCCGGCCATGGTGG + Intergenic
912230777 1:107790180-107790202 GAAAAGGTGGCCAGCCCTGGAGG + Intronic
912532957 1:110339619-110339641 AAGAAGTTAGGGGGCTCTGGTGG + Exonic
912791584 1:112657249-112657271 GAGAAATAGGCCGGGCCTGGTGG - Intronic
913251404 1:116914599-116914621 GAAAAGTTAGCCGGGTATGGTGG + Intronic
913970602 1:143412821-143412843 GAAAAGTTGGCCGGGTGTGATGG - Intergenic
914064978 1:144238432-144238454 GAAAAGTTGGCCGGGTGTGATGG - Intergenic
914084538 1:144440953-144440975 GAGAAGTCGGCCGGGTGCGGTGG - Intronic
914114173 1:144727922-144727944 GAAAAGTTGGCCGGGTGTGATGG + Intergenic
914203083 1:145503826-145503848 GAGAAGTTGGCCAGGCGTGGTGG - Intergenic
914237012 1:145821753-145821775 GAGAAGTTGGCCAGGCGTGGTGG - Intronic
914482205 1:148076980-148077002 GAGAAGTTGGCCAGGCGTGGTGG - Intergenic
914517295 1:148384797-148384819 CAGAAATTAGCCGGCTGTGGTGG + Intergenic
915349582 1:155216060-155216082 GAAAAGTTAGCCGGGTGTGGTGG - Intergenic
915865569 1:159494877-159494899 GAGCAGCTGGCCGGCCCTGCCGG - Intergenic
916712263 1:167422149-167422171 GAGAGGTTGGCAGGGTCTGGGGG - Exonic
917887462 1:179400614-179400636 GAGAAGATGGCCAGGTGTGGTGG + Intronic
919636671 1:200009956-200009978 GTGAAGTTGGCCGTGTGTGGTGG - Intergenic
919814207 1:201427580-201427602 CAGAAGTTAGCCGGGTGTGGTGG + Intronic
921155112 1:212433091-212433113 GAGGAGCTGGCCCGCTATGGCGG + Exonic
924117506 1:240762581-240762603 GAGCAGCTGGCCGGCCCTGTCGG + Intergenic
924327586 1:242911292-242911314 AAGAAGTTGGCCAGGCCTGGTGG - Intergenic
1064457581 10:15502734-15502756 GAAAAGTTAGCCGGGTGTGGTGG + Intergenic
1064482368 10:15752485-15752507 GAGAAATTGGCCAGATGTGGTGG + Intergenic
1064815935 10:19262366-19262388 GAGAACTTGGCCGGGCCCGGTGG + Intronic
1065934671 10:30510719-30510741 GCAAAGTTGGCCGCCTCTAGTGG + Intergenic
1066545089 10:36490987-36491009 GAGAACTGGGCCGGGTGTGGTGG + Intergenic
1066565226 10:36715238-36715260 AAAAAGTTAGCCGGCTGTGGTGG + Intergenic
1067014541 10:42747403-42747425 AAGAACTTGGCCGGGTGTGGTGG - Intergenic
1067022221 10:42811328-42811350 CAGAAATTGGCCGGATGTGGTGG - Intronic
1068000653 10:51330436-51330458 GAGAACGTGGCCGGGTGTGGTGG - Intronic
1068372092 10:56130145-56130167 GACAATTTGGCCGGGTGTGGTGG - Intergenic
1069388179 10:67903672-67903694 CAGAAATTGGCCGGATGTGGTGG - Intronic
1070217063 10:74396244-74396266 CAGAAATTGGCCGGGTGTGGTGG + Intronic
1070224992 10:74494813-74494835 AAGAACTTGGCCGGGTGTGGTGG - Intronic
1070715739 10:78719748-78719770 GAGAAGTTGAGCTGGTCTGGAGG + Intergenic
1070875541 10:79803463-79803485 GTGAAGTTGGCCGGGTGCGGTGG + Intergenic
1071008675 10:80912535-80912557 GTGAATTTGGCCAGCTCTGCAGG + Intergenic
1072672061 10:97437633-97437655 GAGAAGGAGGCCGGGTGTGGTGG - Intronic
1073249245 10:102111696-102111718 GAAAAGTTGGCCGGGTGTGGTGG + Intronic
1074560422 10:114530684-114530706 CAAAAGTTAGCCGGCTATGGTGG - Intronic
1074704988 10:116122516-116122538 GAGAACTTAGAGGGCTCTGGGGG - Intronic
1075580788 10:123616575-123616597 CAGAAGTTGGCCGGGCATGGTGG - Intergenic
1075896416 10:125999350-125999372 AAGAAGTTAGCCGGGTGTGGTGG - Intronic
1076641998 10:131923907-131923929 TAAAAGTTAGCCGGCTGTGGTGG - Intronic
1076835880 10:133020799-133020821 GAGAAGGTCGCCGTCTCTTGAGG - Intergenic
1078133624 11:8634454-8634476 AAGGAGTTGGCCGGGTGTGGTGG - Intronic
1078218956 11:9335533-9335555 GAAAAGTTGGCCAGATGTGGTGG + Intergenic
1078591465 11:12644042-12644064 GAGAAAATGGCCGGGTGTGGTGG + Intergenic
1079098070 11:17523616-17523638 GAGCAGTTGGAAAGCTCTGGTGG + Intronic
1080321944 11:31020258-31020280 GTGAAGTTGTCTGGCTTTGGAGG - Intronic
1080791667 11:35526895-35526917 TAGATGTTGGCGGGCCCTGGTGG + Intronic
1081115341 11:39192820-39192842 GAGCTGCTGGCCGGCTCTGCTGG - Intergenic
1081329724 11:41788495-41788517 GAGCAGCTGGCCGGCCCTGCCGG - Intergenic
1083264522 11:61540495-61540517 GAAAAGTTGGCCGACCCTTGAGG + Intronic
1083424030 11:62573809-62573831 GGTAAGTTTGCTGGCTCTGGTGG - Exonic
1083660618 11:64250384-64250406 GAGAACTTGGCGGGGTGTGGAGG + Intergenic
1083722907 11:64612180-64612202 GAGGAGTTGGCAGGACCTGGAGG + Intronic
1083841398 11:65306593-65306615 CAGAAGTTGGCTGGATATGGTGG - Intergenic
1084331585 11:68433595-68433617 GAGCAGGTGGGCGGCTCTGGGGG - Exonic
1084637438 11:70401181-70401203 GAAAAATTGGCCGGGTATGGTGG + Intronic
1085228835 11:74947236-74947258 GAGAAGTTGGCCTGGTGTGGTGG + Intronic
1085575500 11:77599241-77599263 GAAAAATTAGCCGGCTGTGGTGG - Intronic
1085603271 11:77874747-77874769 AAGAAGTTGGCCGGGTGCGGTGG + Intronic
1085613244 11:77972384-77972406 AAGAAATTGGCCGGGTGTGGTGG - Intronic
1086180584 11:83946273-83946295 CAGAAGTTGGCTGGGTGTGGTGG - Intronic
1088897110 11:114086947-114086969 GAGAAGTTGGCAGGAACAGGAGG - Intronic
1089583460 11:119495731-119495753 TAGCAGTTGGCAGGATCTGGAGG - Intergenic
1091938804 12:4455703-4455725 GTGAACTTGGCCGGGTGTGGTGG + Intergenic
1092039156 12:5368262-5368284 GAAAAGTTGGCTGGGTGTGGTGG + Intergenic
1092172016 12:6379641-6379663 TAGAAGTTGGCCGGGCATGGTGG + Intronic
1093043948 12:14420340-14420362 AAGAAGTTGGCCTGGTGTGGTGG + Intronic
1095471708 12:42543806-42543828 GAGGAGTTGGCCGGGTGCGGTGG - Intronic
1095605094 12:44057750-44057772 GATAAGTTGTGTGGCTCTGGGGG + Intronic
1095901528 12:47333476-47333498 GAGCAGCTGGCCGGCCCTGTCGG + Intergenic
1097075800 12:56392847-56392869 GAAAAGTAGGCCGGCAGTGGTGG + Intergenic
1099375142 12:81889672-81889694 GAGAAATTGGCTGGGTGTGGTGG - Intergenic
1099495416 12:83340290-83340312 GAGAAGTTGGCCAGATGCGGAGG - Intergenic
1100317033 12:93454014-93454036 GAAAAATTAGCCGGCTGTGGTGG - Intergenic
1101510169 12:105385748-105385770 GAAAAATTAGCCGGGTCTGGTGG + Intronic
1101903586 12:108809302-108809324 GAAAAGTTAGCCGGGTGTGGTGG + Intronic
1102380141 12:112458361-112458383 GAAAAATTAGCCGGCTATGGTGG - Intronic
1104679607 12:130740333-130740355 GTGAAGATGTCCGGCACTGGCGG - Intergenic
1104978052 12:132560882-132560904 GAGAAGTTAAGCGGGTCTGGTGG + Intronic
1104978214 12:132561479-132561501 GAGACGAGGGCCGGCTTTGGGGG + Intronic
1105057743 12:133118225-133118247 GTGAAGTTGGCCAGGTGTGGTGG - Exonic
1105565271 13:21539449-21539471 AAGAAATTAGCCGGCTATGGAGG - Intronic
1105975547 13:25469126-25469148 GAGAAGGCGGCCGGCTCGCGCGG + Intronic
1106295821 13:28412847-28412869 GAGAACGTGGCCGGCCGTGGTGG - Intronic
1106559676 13:30837580-30837602 GTTAAGTGGGCCTGCTCTGGAGG + Intergenic
1107214691 13:37902726-37902748 TAGAAGTTGGCCTGGCCTGGTGG + Intergenic
1107239886 13:38219538-38219560 GAAAAGATGGCCGGGTGTGGTGG - Intergenic
1107399813 13:40058475-40058497 GAGTAGATGGCCGGGTCAGGGGG - Intergenic
1109197688 13:59396257-59396279 GAGAAGTTGGCCAGGTGTGGTGG - Intergenic
1109335370 13:60987214-60987236 GAGAAGTTGGCCGGGCGCGGTGG - Intergenic
1109919483 13:69036844-69036866 TAGAAGTTGGCCGGGCATGGTGG - Intergenic
1110214500 13:73011112-73011134 GAAAAGTTGGCTGGGTGTGGTGG - Intronic
1110247410 13:73342265-73342287 CAGAAGTTAGCTGGGTCTGGTGG + Intergenic
1110749375 13:79094972-79094994 GAGATGTTGGCTGCCTGTGGAGG - Intergenic
1111441891 13:88291911-88291933 GAGCAGCTGGCCGGCCCTGCCGG + Intergenic
1111456470 13:88491059-88491081 GTGAAGTTGGCCGGGCCTGGTGG + Intergenic
1111459416 13:88519986-88520008 GTGAAGGTGGCCGGCAGTGGTGG + Intergenic
1113409193 13:110069267-110069289 GTGAAGTTGGCCGGGCGTGGTGG - Intergenic
1113877778 13:113605554-113605576 GAGATGTTGCCCAGCTCTGCAGG + Intronic
1114070821 14:19104840-19104862 AAGAACTTGGCCGGGTGTGGTGG + Intergenic
1114091440 14:19295166-19295188 AAGAACTTGGCCGGGTGTGGTGG - Intergenic
1114480469 14:23030642-23030664 GAAAAGTTGGCCAGATATGGTGG + Intronic
1116844318 14:49851049-49851071 GAGAAATTAGCCGGGTCTGGTGG + Intronic
1117324644 14:54658019-54658041 GAGAATGTGGCCGGCCGTGGTGG + Intronic
1118305104 14:64649119-64649141 GGGAAATTGGCCGGGTGTGGTGG + Intergenic
1120523090 14:85547474-85547496 GAAAAGTTAGCCGGGTGTGGTGG - Intronic
1120537881 14:85719368-85719390 GACAAGTTGGCCAGGTGTGGTGG - Intergenic
1120557941 14:85953697-85953719 GGAAAGTTGGCCGGATCAGGAGG - Intergenic
1122062300 14:99144112-99144134 GAGAGCCTGGCTGGCTCTGGTGG - Intergenic
1122276629 14:100594081-100594103 GAGAAGTGGACCGGGGCTGGGGG - Intergenic
1124178805 15:27453887-27453909 AAGAAGTTGGCTGGGTGTGGTGG - Intronic
1124459499 15:29876230-29876252 GAGATTTTGGCCGGGTGTGGTGG + Intronic
1125327441 15:38550103-38550125 GAAAAATTAGCTGGCTCTGGTGG + Intronic
1125625426 15:41104825-41104847 GATAAGTTGGCCGGGTGTGGTGG - Intronic
1125688526 15:41578298-41578320 GGCCATTTGGCCGGCTCTGGTGG + Exonic
1125819229 15:42613810-42613832 CAGAAGTTAGCCGGGTGTGGTGG + Intronic
1125978626 15:43978837-43978859 GAAAACTTGGCCGGGTGTGGTGG - Intronic
1127253280 15:57265015-57265037 AAAAAGTTGGCCGGGTGTGGTGG - Intronic
1127272361 15:57413143-57413165 GAGAAGAAGGCCGGGTGTGGTGG - Intronic
1127615185 15:60677530-60677552 GAGAAGTTGCCTGACTCTGAGGG - Intronic
1127893118 15:63272293-63272315 AAAAAGTTAGCCGGCCCTGGTGG - Intergenic
1128043048 15:64592423-64592445 GAAAATTTAGCCAGCTCTGGTGG + Intronic
1128125875 15:65192481-65192503 GAGAAATTGGCCGGGTGCGGTGG + Intergenic
1129281960 15:74492419-74492441 CAGAAGTTAGCCGGGTGTGGTGG - Intergenic
1129337276 15:74860260-74860282 CAAAAATTGGCCGGGTCTGGTGG + Intronic
1129339722 15:74877556-74877578 GATAATTTGGCCGGGTGTGGTGG - Intergenic
1129617018 15:77106649-77106671 AAGAAGTTGGCCGGATGTGGTGG - Exonic
1131846137 15:96492106-96492128 GAGCAGCTGGCCGGCCCTGCCGG - Intergenic
1132617436 16:848733-848755 GAGAAGGTGGACGGCTCTCGGGG - Intergenic
1134438985 16:14286226-14286248 GAGAAGATGGAGGGCTCTGGGGG + Intergenic
1136424951 16:30163751-30163773 AAGAAGTTGGCTGGGTGTGGTGG + Intergenic
1137695028 16:50455740-50455762 GAGAAGTTGGCCAGATTTGCTGG - Intergenic
1139595983 16:67958544-67958566 GAGAGGTTGACAGGCTCAGGAGG - Intronic
1139723898 16:68880123-68880145 AAGAAGTTAGCCGGGTGTGGTGG - Intronic
1140434793 16:74937787-74937809 AAGAAGTTGGCCGGGCATGGTGG - Intronic
1140776627 16:78254814-78254836 GGGAAGTTGGCCAGATGTGGTGG - Intronic
1140836866 16:78802761-78802783 GAGAAGTTAGCCAGGTGTGGTGG + Intronic
1141191668 16:81829503-81829525 GAGAAATGGGCCGGGTGTGGTGG - Intronic
1141776473 16:86126437-86126459 GAGAAGTAGGCTGGCCATGGTGG + Intergenic
1142080327 16:88145755-88145777 GAGCAGTTGCCCGGCACTGGGGG - Intergenic
1142250391 16:88989303-88989325 GAGATGCTGGCCGGGGCTGGGGG - Intergenic
1142455345 16:90218052-90218074 GAGATGGGGGCCGGCTCTGCTGG + Intergenic
1142576509 17:912223-912245 GAGTATTTGGCCGGGTGTGGTGG - Intronic
1142807087 17:2376866-2376888 GAGAGGGTGGCCAGGTCTGGAGG + Intronic
1142928573 17:3262283-3262305 ACAAAGTTGGCCTGCTCTGGAGG + Intergenic
1143184072 17:5000102-5000124 GAGAGGCTGGGTGGCTCTGGGGG + Intronic
1143606285 17:7988277-7988299 GAGAAGGAGGCCGGGTGTGGAGG - Intergenic
1143996885 17:11014107-11014129 GAGAATTTGGAGAGCTCTGGAGG - Intergenic
1144863185 17:18318554-18318576 GAAAAGTTAGCCGGGTGTGGTGG - Intronic
1146284156 17:31563248-31563270 CAAAAGTTAGCCGGCTGTGGTGG - Intergenic
1147268142 17:39247330-39247352 GAAAAGTTGGCTGGGTGTGGTGG - Intergenic
1147669451 17:42168356-42168378 AAGAATTTGGCCGGCTGTGGTGG + Intronic
1147750735 17:42731268-42731290 AAAAATTTGGCCGGCTATGGTGG - Intronic
1148498323 17:48069000-48069022 GACAAGTTGGCCGGATGTGGTGG + Intergenic
1149608631 17:57942674-57942696 GACAATTTGGCCGGGTGTGGTGG - Intronic
1149656641 17:58312617-58312639 GACAAATCGGCCAGCTCTGGAGG + Exonic
1149809815 17:59657613-59657635 AAAAAGTTAGCCGGCTGTGGTGG + Intronic
1149864203 17:60141396-60141418 GAGGAGTAGGCAGGCTCGGGAGG + Intergenic
1150338604 17:64347881-64347903 CAAAAATTAGCCGGCTCTGGTGG - Intronic
1150363798 17:64562663-64562685 GAGAAATTGGCCGGGTGCGGTGG - Intronic
1151211949 17:72550974-72550996 GAGAAGTCGGCCGGGCGTGGTGG - Intergenic
1151460814 17:74253045-74253067 TAGAAGATGGCCGGCTGTGAAGG - Intronic
1151466231 17:74287253-74287275 GAGAAGTGGCCCTGCTCTGGGGG + Intronic
1151900649 17:77011110-77011132 GTGAAATTGGCCGGGTATGGTGG + Intergenic
1152319564 17:79600911-79600933 GAGAAGTCCGCTGGCTCTGAAGG + Intergenic
1152399424 17:80056472-80056494 GAGAAATTGGCCGGGCATGGTGG + Intronic
1152417645 17:80173031-80173053 GAAAAATTAGCCGGCTGTGGTGG - Exonic
1152608892 17:81306115-81306137 GAGAGGAGGGCCGGCCCTGGGGG + Intergenic
1153848257 18:9069217-9069239 TTGAAGTTGGCCGGGTGTGGTGG - Intergenic
1154122908 18:11665934-11665956 GACAAGTAGGCTGGCCCTGGAGG - Intergenic
1154195700 18:12264838-12264860 GAGAAGTTGGCCGGGCGCGGTGG - Intronic
1157310778 18:46551388-46551410 TAGGAGTTGGCCGGGTGTGGTGG - Intronic
1157342514 18:46791887-46791909 GAGCAGTTGCCAGGCTTTGGGGG - Intergenic
1157975777 18:52325289-52325311 GTGAAATTGGCCGGGTGTGGAGG + Intergenic
1158007781 18:52692717-52692739 GAGAAGCTGGCCAGGTGTGGTGG - Intronic
1158273961 18:55746403-55746425 GAAAAATTGGCCGGGTGTGGTGG - Intergenic
1159977880 18:74738450-74738472 GAGAAGTTGGCCGGGTGTGGTGG + Intronic
1161623014 19:5309157-5309179 GGGGGGTTGGCTGGCTCTGGTGG + Intronic
1161877400 19:6922326-6922348 GAGGTGTTGGCCGGGTGTGGTGG + Intronic
1162590043 19:11585439-11585461 GAGAAGTGGGCTGGGTGTGGTGG + Intronic
1162686984 19:12395292-12395314 CAAAAGTTGGCCGGATGTGGTGG - Intronic
1162771362 19:12951262-12951284 GTGAACTTGGCCGGGTGTGGTGG - Intronic
1164109533 19:22142519-22142541 GAAAAGTTGGCCAGGTGTGGTGG - Intergenic
1164391837 19:27829919-27829941 GTAAAGTTGGCCGGGTGTGGTGG - Intergenic
1165177699 19:33942147-33942169 AACACGTTGGCAGGCTCTGGAGG + Intergenic
1165580836 19:36862146-36862168 GAGAAGTTGGCCGGGTGCAGTGG - Intronic
1167507630 19:49879246-49879268 GAGAAGTTGGATGCCTCTGTAGG + Intronic
1168093589 19:54101701-54101723 GAAAAATTAGCCGGCTGTGGAGG + Intronic
1168329458 19:55558649-55558671 CAGAAGTTAGCCGGGTGTGGTGG - Intergenic
926326194 2:11786464-11786486 GAGAAGGTGGCAGGGTCAGGAGG - Intronic
926621954 2:15054697-15054719 GATCAGTTGGCCCGATCTGGAGG - Intergenic
927529562 2:23782102-23782124 CAGAAGTTGGCTGGGTGTGGTGG - Intronic
927681616 2:25143369-25143391 GAAAAGTTGGCCGGGCATGGTGG + Intronic
927837904 2:26415777-26415799 CAGAAGTTGGCTGGGCCTGGTGG + Intronic
927990671 2:27444798-27444820 CAAAAGTTAGCCGGGTCTGGTGG - Intronic
928210864 2:29322679-29322701 CAGAAATTAGCCGGGTCTGGTGG + Intronic
929183590 2:39069698-39069720 CAGAAATTGGCCGGGTGTGGTGG - Intronic
929536516 2:42787539-42787561 GAGGAGTTGGCTGGTTCTGCTGG + Intronic
929965132 2:46528980-46529002 GAGAAGTTGGCCCAGGCTGGAGG + Intronic
930039196 2:47107372-47107394 GAGCAGCTGGCCGGCCCTGCCGG + Intronic
930205759 2:48585398-48585420 AAGAAGTTAGCCGGGTGTGGTGG - Intronic
931548895 2:63420379-63420401 GAAAAATTAGCCGGCTATGGTGG + Intronic
932084149 2:68743211-68743233 GAGATGGTGGGCAGCTCTGGAGG - Intronic
932607058 2:73172436-73172458 AAGAAGTGAGCTGGCTCTGGAGG - Intergenic
933496591 2:83057483-83057505 AAGAAGTTGGTCGGGTGTGGTGG - Intergenic
933925372 2:87087975-87087997 AAGAAGTGAGCTGGCTCTGGAGG + Intergenic
934285613 2:91648107-91648129 GAAAAGTTGGCCGGGTGTGATGG - Intergenic
935219152 2:100997374-100997396 GAGATGTTGGCTGGGTGTGGTGG - Intergenic
935735607 2:106104521-106104543 GTGAAGTTGCCCAGCTCTGAGGG - Intronic
937359524 2:121219113-121219135 GAGACCTTGCCCTGCTCTGGGGG + Exonic
937375750 2:121334755-121334777 GAGGACTTGGAAGGCTCTGGAGG - Intergenic
937627167 2:124056491-124056513 GAAAAATTAGCCGGCTGTGGTGG + Intronic
937746981 2:125426057-125426079 GAGAAATTGGCCAGGTATGGTGG + Intergenic
937918450 2:127112917-127112939 GTGAAGTTGGCTGTCTCAGGAGG - Intergenic
938869150 2:135455473-135455495 AAGAAGTCGGCCGGCCATGGTGG - Intronic
938882350 2:135603892-135603914 CAGAACTTGGCCGGCTGCGGTGG - Intronic
939301325 2:140343919-140343941 GAGAAGTGGGCAGGGTCTGGGGG + Intronic
939721823 2:145663231-145663253 GAAAAGGTGGCCGGGTGTGGTGG - Intergenic
942994511 2:182245042-182245064 GTTAAGTTGGCTGGCTTTGGAGG - Intronic
943680459 2:190761743-190761765 CAGAAGTTAGCCGGTTATGGTGG - Intergenic
944024768 2:195150500-195150522 AAAAAGTTAGCCAGCTCTGGTGG + Intergenic
944149240 2:196539480-196539502 AAAAAATTGGCCGGCTGTGGTGG + Intronic
944407974 2:199407031-199407053 GAAAAGTTGGCTGGGTGTGGCGG + Intronic
944550603 2:200841351-200841373 GAGAAATTGGCTGGGTGTGGTGG + Intergenic
946356777 2:219191225-219191247 GGGTAGTTGGCCGGGTGTGGTGG + Intergenic
947822541 2:233082051-233082073 GAGAAGATGGGCGGCTCTGCTGG + Intronic
948065414 2:235075016-235075038 GAGAAGTCAGCCAGCTCTTGGGG + Intergenic
948214476 2:236218509-236218531 CAGAAATTGGCCGGATGTGGTGG + Intronic
948562371 2:238863168-238863190 GAGTAGTTGCCCTTCTCTGGAGG - Intronic
948977838 2:241474501-241474523 GAGAAGGTGGCCGGGCATGGTGG + Intronic
949086826 2:242162778-242162800 GAGATGGGGGCCGGCTCTGCTGG + Intergenic
1169704206 20:8484310-8484332 GAGAAGGTGGCCGGGTGTAGTGG - Intronic
1170035481 20:11985071-11985093 GAGAAATGGGCCGGGCCTGGTGG - Intergenic
1170354459 20:15477251-15477273 AAGAAGTTTGCCTGCTATGGTGG - Intronic
1171346781 20:24471159-24471181 GAGAAGTTGGCCGGCTCTGGGGG - Intronic
1171955894 20:31463422-31463444 CAGAAATAGGCCGGCTGTGGTGG - Intergenic
1172012281 20:31852521-31852543 GAGATGTTGGCCGGGCATGGTGG + Intronic
1173512166 20:43638476-43638498 TAGAAGTTGGCCGGACGTGGTGG - Intronic
1174218287 20:48933830-48933852 GGGAAGTTGGCCGGGTGCGGTGG + Intronic
1174619738 20:51864866-51864888 CAGAAGTTAGCCGGGTGTGGTGG + Intergenic
1174717348 20:52773722-52773744 GAGAAATTGGCTGGGTATGGTGG - Intergenic
1174743546 20:53039818-53039840 GTGAAGAGGGCCGGCTGTGGTGG + Intronic
1175870406 20:62206668-62206690 GGGAAGATGACCGGCTCTGAAGG + Intergenic
1175888009 20:62303142-62303164 GAGAAGGTGGCCGGCGCGGCGGG + Intronic
1175930831 20:62493051-62493073 GAGAAAGTGGGGGGCTCTGGGGG - Intergenic
1176151725 20:63594899-63594921 CAGAAGTTAGCCGGGTGTGGTGG - Intronic
1176216455 20:63950289-63950311 GGAAAGTTGGCCGGGTGTGGTGG + Intronic
1176317762 21:5264350-5264372 GAGAAGTTTGCCTCCTATGGTGG - Intergenic
1176384493 21:6131780-6131802 CAGAAGTTAGCCGGCTGTGGTGG + Intergenic
1176475627 21:7201125-7201147 GAGAAGTTTGCCTCCTATGGTGG - Intergenic
1178320801 21:31604138-31604160 GAGAACTTGGCTGGGTGTGGTGG + Intergenic
1179738979 21:43406472-43406494 CAGAAGTTAGCCGGCTGTGGTGG - Intergenic
1179927292 21:44542594-44542616 GAAAAGTTGGCCCACTTTGGTGG + Intronic
1180090729 21:45532720-45532742 GAGAAGCTGGCTGGGTGTGGTGG - Intronic
1180393465 22:12306271-12306293 GAAAAGCAGGCCGGCTGTGGTGG - Intergenic
1180406283 22:12558497-12558519 GAAAAGCAGGCCGGCTGTGGTGG + Intergenic
1180489285 22:15827305-15827327 AAGAACTTGGCCGGGTGTGGTGG + Intergenic
1180983132 22:19888744-19888766 GTGAGGGTGGCTGGCTCTGGGGG - Intronic
1181154476 22:20910343-20910365 GAAAAGTTGGCCGGGTATGGTGG + Intergenic
1181337511 22:22150338-22150360 TAGAAGTTGGCCAGGTGTGGTGG - Intergenic
1182842151 22:33399833-33399855 CAGAAGTTGGCCGGGCGTGGTGG - Intronic
1182873979 22:33674229-33674251 GGGAAGTTGGCTGGGTGTGGTGG - Intronic
1183385549 22:37512146-37512168 CAGAAGTTGGCCTGGTATGGGGG + Intronic
1183524483 22:38315414-38315436 CAGAGTTTGGCCAGCTCTGGTGG - Intronic
1183862412 22:40679561-40679583 GACAAGGTGGCAGGCGCTGGAGG + Exonic
1184931137 22:47682217-47682239 GAGATGCTGGCAGGATCTGGGGG - Intergenic
1185349981 22:50330099-50330121 AAGTAGTTGGCCGGGTATGGTGG + Intergenic
949254611 3:2030808-2030830 CAGAAATTGGCCGGATGTGGTGG - Intergenic
950095405 3:10326600-10326622 GAGCAGTGGGCTGGCTTTGGTGG + Exonic
950518978 3:13485103-13485125 GGGAAGTTGGCCGGGCCTTGGGG + Intronic
950912949 3:16614036-16614058 GGGAAGCTGGCCGGCCGTGGTGG - Intronic
951036401 3:17937462-17937484 GAGGAATTAGCTGGCTCTGGTGG + Intronic
951376781 3:21928069-21928091 AAAAAGTTAGCCGGCTGTGGTGG + Intronic
951479377 3:23143190-23143212 GAGAAATTAGCCGGGTGTGGTGG + Intergenic
952493913 3:33899353-33899375 GAGAAGATGGCCGGGTACGGTGG + Intergenic
953197846 3:40750814-40750836 GAAAACTAGGCCGGCTGTGGTGG + Intergenic
954820730 3:53324731-53324753 GAAAAGTTGGCTGGGTGTGGTGG + Intronic
954944657 3:54410061-54410083 GAGAAGTCGGCTGGGTGTGGTGG + Intronic
956679674 3:71766898-71766920 GTGAAGTTGGCCGGGTGTGGTGG + Intergenic
957848275 3:85768291-85768313 GAAAAATTAGCCGGGTCTGGTGG + Intronic
959533303 3:107458087-107458109 AAGAAGTTGGGCTGCTTTGGTGG - Intergenic
961412822 3:126735155-126735177 GAAAAGTTGGCCTCCTCTAGAGG + Intronic
962678049 3:137770674-137770696 GAGAAGTTGCTCTACTCTGGAGG + Intergenic
963433102 3:145234717-145234739 GAGAAGGTGGCCGGGCATGGTGG + Intergenic
963533250 3:146497390-146497412 GAGCAGCTGGCCGGCCCTGCCGG + Intergenic
964751845 3:160060616-160060638 GAGCAGCTGGCCGGCCCTGCCGG + Intergenic
965807446 3:172556843-172556865 GAGAATTGGGCCGGGTGTGGTGG + Intergenic
965917033 3:173862054-173862076 GAAAAATTGGCCGGGTGTGGTGG - Intronic
966718184 3:183034928-183034950 GAAAAGTTAGCCAGCTGTGGTGG - Intronic
967756259 3:193173168-193173190 GAGAAGATGGCCAGGTGTGGTGG + Intergenic
968384461 4:124146-124168 CAGAAATTGGCCGGGTGTGGTGG + Intergenic
968651460 4:1761818-1761840 GAGCAGGTGGCGGGGTCTGGAGG - Intergenic
970127901 4:12834899-12834921 GAGAAGGAGGCCGGGTGTGGTGG - Intergenic
971842724 4:31874958-31874980 AAGAAGCTGGCCGGGTGTGGTGG + Intergenic
972522053 4:39868311-39868333 GATAATTTGGCCGGGTGTGGTGG - Intronic
974018799 4:56675004-56675026 GAGAAGTTGGCTGGGCATGGTGG - Intronic
974057268 4:56996796-56996818 GAGAAGGTGGCCAGGTGTGGTGG + Intronic
974503306 4:62733286-62733308 AACAAGTTGGCCGGGTGTGGTGG - Intergenic
974573297 4:63684170-63684192 GACAAGTTGGCCGGGTACGGTGG + Intergenic
976306847 4:83568658-83568680 AAAAAGTTGGCCGGGTGTGGTGG - Intronic
976716977 4:88133708-88133730 GAGAATTTGGCCGGGTGTGGTGG + Intronic
978210252 4:106126919-106126941 AAGAAGTTGGCTGGGTGTGGTGG + Intronic
980919886 4:139073841-139073863 GAGAAGTTGGCCAGGCATGGTGG + Intronic
981968724 4:150638312-150638334 AAGAAGTTGGCCGGGCGTGGTGG - Intronic
982474057 4:155828435-155828457 GATAAGTAGGCCGGGCCTGGAGG + Intergenic
982868825 4:160550385-160550407 GAGCAGCTGGCCGGCCCTGCCGG - Intergenic
983681059 4:170354096-170354118 ATGAAGTTGGCCGGGTATGGTGG + Intergenic
984408558 4:179366302-179366324 GATAAGTGGGCCGGGTGTGGTGG + Intergenic
984427776 4:179609556-179609578 CAGAAGTTAGCCGGGTGTGGTGG + Intergenic
984542418 4:181056092-181056114 GTGAAGTTGGCCGGGTGCGGTGG - Intergenic
984902195 4:184595244-184595266 AAGAAATTGGCCGGATATGGTGG - Intergenic
985258205 4:188090542-188090564 GAGAGGTAGGCCGGGTGTGGTGG + Intergenic
986160570 5:5224574-5224596 AAGCAGTTGGCCGGATGTGGTGG - Intronic
986864033 5:11963221-11963243 GTAAAGTTGGCCGGCTGCGGTGG - Intergenic
987320419 5:16763993-16764015 GAAAAATTAGCCGGCTGTGGTGG + Intronic
987682852 5:21160232-21160254 AAGAAATTAGCCGGCTGTGGTGG - Intergenic
988073487 5:26324553-26324575 GAGCAGCCGGCCGGCTCTGCCGG + Intergenic
988506886 5:31831459-31831481 CAAAAATTGGCCGGCTGTGGTGG + Intronic
988570197 5:32357551-32357573 TACAAGTTGGCTGGCCCTGGTGG - Intronic
990458519 5:56012275-56012297 GAGAAGGTGGCAGGCTGCGGAGG + Intergenic
990522309 5:56591986-56592008 GAGAAATCGGCCGGGTGTGGTGG - Intronic
990580968 5:57167359-57167381 AAGAATTTGGCCGGGTGTGGTGG + Intergenic
990724815 5:58741715-58741737 GATAAGTTGGCCAGGTGTGGTGG + Intronic
991300543 5:65125245-65125267 GAGAAATTAGCCGGATGTGGTGG - Intergenic
991990597 5:72334834-72334856 GAAAAGTTGGCCGGGCGTGGTGG - Intronic
994055455 5:95409309-95409331 GAAAAGTTAGCCGGATGTGGTGG - Intronic
994254805 5:97580261-97580283 GAGCAGCTGGCCGGCCCTGCCGG - Intergenic
995459192 5:112385101-112385123 GAGTACTTAGCAGGCTCTGGTGG - Intronic
996107032 5:119517197-119517219 GAGCAGCTGGCCGGCCCTGCTGG + Intronic
996111061 5:119567425-119567447 GAGAAGTTGGGAGCTTCTGGAGG - Intronic
996360387 5:122638774-122638796 CAGAACTTGGAAGGCTCTGGCGG + Intergenic
997083014 5:130763184-130763206 GGGAAGCTGGCCGGGTGTGGTGG - Intergenic
997270510 5:132532747-132532769 GAGAACGTGGCCGGGTGTGGTGG - Intergenic
997449129 5:133968021-133968043 GAGGAGGTGGCCGGGGCTGGGGG - Intronic
997546909 5:134716315-134716337 AAAAAATTGGCCAGCTCTGGTGG + Intronic
997904968 5:137807432-137807454 CAGAAGTTGGCCGGGCATGGTGG + Intergenic
998249993 5:140546118-140546140 GAGAAGCTGGCCAGGTGTGGTGG + Intronic
998400687 5:141847346-141847368 GGGGAGTTGGCCGGGTGTGGTGG - Intergenic
998649257 5:144099652-144099674 TAGCAATTGGCCGGTTCTGGTGG + Intergenic
999444140 5:151625669-151625691 GAGAAGATGGCCGGGTGCGGTGG + Intergenic
999790236 5:154932850-154932872 GAAGAGTTGGCCGGGTGTGGTGG - Intronic
1001317177 5:170652064-170652086 GAGGAGCTGGCTGGCTGTGGGGG + Intronic
1002016987 5:176332441-176332463 GCAAAGTTAGCCGGGTCTGGTGG - Intronic
1002376340 5:178791778-178791800 TAGAAGTTGGCCGGGCGTGGTGG - Intergenic
1004000620 6:11593803-11593825 GAGAAATGGGCCGGGACTGGTGG - Intergenic
1004508996 6:16269506-16269528 CAGAAGTTGGCCTGGTGTGGTGG + Intronic
1004574382 6:16880333-16880355 GAAAAGTTAGCCGGATGTGGTGG + Intergenic
1005446559 6:25930103-25930125 GAGAACATGGCCGGGCCTGGTGG - Intronic
1005600887 6:27425095-27425117 GAGCAGCCGGCCGGCCCTGGCGG - Intergenic
1006650633 6:35548500-35548522 CAAAAATTAGCCGGCTCTGGTGG - Intergenic
1007377382 6:41466180-41466202 GAGAAGGGGGCCGGGTGTGGTGG + Intergenic
1008068131 6:47072345-47072367 GAGTTGTTGGCCGGGTGTGGTGG - Intergenic
1008399360 6:51046961-51046983 CAGAAGTTGGCCAGGTGTGGTGG - Intergenic
1008664405 6:53701864-53701886 GAACAGATGGCAGGCTCTGGGGG + Intergenic
1008908570 6:56707880-56707902 GAAAAGATGGCCGGGTGTGGTGG + Intronic
1009357855 6:62774473-62774495 GAAAAATTAGCCGGCTGTGGTGG - Intergenic
1010743623 6:79536910-79536932 GGGAGGTTGACCGGCACTGGGGG - Intronic
1013527095 6:110984551-110984573 GAGATTTTGGCCGGCCCTTGTGG + Intronic
1014190479 6:118490059-118490081 GACAAGATGGATGGCTCTGGGGG + Intronic
1014250262 6:119108451-119108473 TAGAAGGTGGCCAGCACTGGTGG + Intronic
1015319955 6:131861880-131861902 GACAAGTGGGCCAGCTGTGGTGG + Intronic
1015445131 6:133294866-133294888 AAGAAATTGGCCGGCTGTGGTGG - Intronic
1017409373 6:154152022-154152044 GAAAAGTTAGCCGGGTATGGTGG + Intronic
1017435118 6:154408308-154408330 GAGAAGTTGGCCAGGTGCGGTGG - Intronic
1017911704 6:158798779-158798801 GAAAAATTAGCCGGCTGTGGTGG - Intronic
1019583271 7:1780131-1780153 AAAAAGTTGGCCGGGTGTGGCGG - Intergenic
1019835532 7:3379320-3379342 GAGAAGTTGCCCTGCGCTGAGGG + Intronic
1019868242 7:3733486-3733508 TACAAGTTGCCCTGCTCTGGAGG + Intronic
1020172507 7:5856120-5856142 GAGCAGTGGGCCGGGTGTGGTGG - Intergenic
1021220438 7:17969698-17969720 GAGTAGTTGGCCAGGTGTGGTGG + Intergenic
1021847887 7:24780144-24780166 GAGAAGTTGGCTGGCCCTTCTGG + Intergenic
1021854998 7:24846662-24846684 GAGAACTTGGTAGGCTGTGGGGG + Intronic
1021979565 7:26041089-26041111 GAGAAGAAGGCCGGGTGTGGTGG + Intergenic
1022679763 7:32533152-32533174 CAAAAATTGGCCGGCTGTGGTGG + Intronic
1023566167 7:41525755-41525777 GAGAAATTGGCAGGGTATGGTGG - Intergenic
1025058180 7:55782053-55782075 CAGAAGCTGGCCGGGTGTGGTGG + Intergenic
1025276442 7:57585783-57585805 AAGAAGTTGACCAGGTCTGGTGG - Intergenic
1026465139 7:70647285-70647307 GAAACGCTGGACGGCTCTGGGGG + Intronic
1026497914 7:70919545-70919567 GAGTAACTGGCAGGCTCTGGAGG - Intergenic
1027255359 7:76427362-76427384 AAGAAGTTAGCCGGGTGTGGTGG + Intronic
1028606639 7:92662829-92662851 GAGAAGTTGGGAGGCTTTGGCGG + Intronic
1029460973 7:100693860-100693882 CCGAGGCTGGCCGGCTCTGGGGG + Intergenic
1031560957 7:123237544-123237566 GAGAAGTGGACAGACTCTGGGGG + Intergenic
1032110365 7:129070565-129070587 GAAAAGCTGGCCGGGTGTGGTGG - Intergenic
1032229889 7:130065364-130065386 AAGAAGTTAGCCGGGTATGGTGG - Intergenic
1032900304 7:136299897-136299919 CAAAAATTGGCCGGGTCTGGTGG + Intergenic
1033192196 7:139291695-139291717 GAAAAGTTAGCTGGGTCTGGTGG + Intronic
1033346711 7:140531017-140531039 TAGAAGTCGGCCGGATGTGGTGG - Intronic
1034594712 7:152179146-152179168 CAAAAATTGGCCGGCTATGGCGG - Intronic
1034604699 7:152301215-152301237 GAAAAGTTGGCCGGGTGTGATGG + Intronic
1034747534 7:153536406-153536428 GAGAACTTGGCCAGGTGTGGTGG - Intergenic
1035317300 7:158004203-158004225 GAGAAGTAGGCAGGGTCTAGGGG + Intronic
1035497883 8:68491-68513 GAGATGGGGGCCGGCTCTGCTGG - Intergenic
1035999229 8:4582920-4582942 GAGCAGCTGGCCGGCCCTGCCGG + Intronic
1036184498 8:6612329-6612351 GGGAAGTGGGCTGGCTGTGGAGG - Intronic
1037780986 8:21868944-21868966 GGGAGGTTGGCCGGGTGTGGTGG + Intergenic
1037942175 8:22959874-22959896 GAAATGTTGGCCGGGTGTGGTGG + Intronic
1039560569 8:38509484-38509506 GAAAAATTGGCCGGGTGTGGTGG - Intergenic
1043011958 8:74892304-74892326 GAAAAATTGGCCTGCTGTGGTGG - Intergenic
1043168489 8:76934321-76934343 GAAAAATTAGCCGGGTCTGGTGG + Intergenic
1043519348 8:81027287-81027309 TAGAAATTGGCCAGCTGTGGTGG - Intronic
1043870481 8:85426294-85426316 GAGAAGTAGGCCGGGTGTGGTGG + Intronic
1045733327 8:105266832-105266854 TAGAAGTTGGCCGGGTATGGTGG + Intronic
1049440520 8:142607370-142607392 GAGAAGTTAGCCGGTTGTGGTGG + Intergenic
1049591109 8:143463134-143463156 GAAAAGTTAGCCGGTTGTGGCGG - Intronic
1050548104 9:6726209-6726231 GAGAATCTGGCCGGTTGTGGTGG - Intronic
1054962366 9:70982984-70983006 GAGAACTTGGCCAGGTGTGGTGG - Intronic
1054991168 9:71328451-71328473 GAGAAGTCGGCCGGGTGCGGTGG - Intronic
1055201012 9:73661998-73662020 AAGAAGTTGGCCGGGCTTGGTGG - Intergenic
1055294927 9:74824437-74824459 GAGAAGTGGGCCAGGTGTGGTGG - Intronic
1055639655 9:78309648-78309670 AAGATGTTGGCCGGTTGTGGTGG - Intronic
1055810612 9:80143687-80143709 GAGAAGTTGGTCGGATAAGGTGG + Intergenic
1056454994 9:86751550-86751572 GAGAAGTTGGTCGGATTTGGAGG - Intergenic
1057407967 9:94790547-94790569 GAGAGAATGGCTGGCTCTGGTGG + Intronic
1059220180 9:112608499-112608521 GAGAATTTGGCTGGGTGTGGTGG + Intronic
1059737598 9:117117871-117117893 GTGAACTTCGCAGGCTCTGGGGG + Intronic
1059971665 9:119674906-119674928 AAAAAGTTGGCCGGGTGTGGTGG - Intergenic
1060189509 9:121583098-121583120 GAGAAGCTGGCCGGCCGCGGTGG + Intronic
1061004384 9:127920346-127920368 GAAAAGTTAGCCAGCTGTGGTGG - Intergenic
1203411061 Un_KI270579v1:3814-3836 GAGAAGTTTGCCTCCTATGGTGG - Intergenic
1186453277 X:9690879-9690901 AAGAAGTTAGCCAGCCCTGGTGG - Intronic
1186456438 X:9713578-9713600 CAAAAGTTAGCCGGCTGTGGTGG - Intronic
1186865564 X:13717584-13717606 CAAAAATTGGCCGGCTGTGGTGG + Intronic
1187139030 X:16575545-16575567 GAGCAGCTGGCCGGCCCTGCGGG + Intergenic
1189370850 X:40427881-40427903 GAGAAGTTGGCCGGACGCGGTGG - Intergenic
1189856059 X:45226229-45226251 GATATGTTGGCCGGGTATGGTGG - Intergenic
1190284105 X:48950847-48950869 CAGAAGTTGGCCGGGTGCGGTGG - Intronic
1192510256 X:71717088-71717110 GGGAAGGTGGCCGGCTCCGGGGG + Exonic
1192516441 X:71764465-71764487 GGGAAGGTGGCCGGCTCCGGGGG - Exonic
1192522525 X:71814909-71814931 GGGAAGCTGGCCGGATCAGGTGG - Intergenic
1192529379 X:71872229-71872251 GGGAAGGTGGCCGTTTCTGGGGG + Intergenic
1192753174 X:74016316-74016338 GAGAAGTAGGCCGGGCATGGTGG + Intergenic
1193297209 X:79847104-79847126 TAGGAGTTGGCCGGGTGTGGTGG + Intergenic
1195251476 X:103052161-103052183 AAAAAGTTGGCCGGGTGTGGTGG + Intergenic
1196108197 X:111918343-111918365 GAGAAGTTGGCAGGGTGTGTGGG + Intronic
1196761993 X:119208741-119208763 GAGCAGCTGGCCGGCCCTGCCGG - Intergenic
1197216585 X:123872398-123872420 AATAAGTTGGCCGGGTGTGGTGG + Intronic
1197310710 X:124901731-124901753 CAGAAATTGGCCGGGTATGGTGG - Intronic
1198376104 X:136041587-136041609 GAGAAGTCAGCCAGCTCTGTTGG + Intronic
1201224997 Y:11810206-11810228 AAGAAGTTGGCCAGGCCTGGTGG - Intergenic
1201596845 Y:15679921-15679943 GAGAATTTTGCTGGCTCAGGAGG + Intergenic