ID: 1171346782

View in Genome Browser
Species Human (GRCh38)
Location 20:24471160-24471182
Sequence GGAGAAGTTGGCCGGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346782_1171346794 14 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346782_1171346791 12 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346782_1171346790 0 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346782_1171346789 -1 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346782_1171346792 13 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346782_1171346796 25 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346782_1171346795 19 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346782 Original CRISPR GGAGAAGTTGGCCGGCTCTG GGG (reversed) Intronic
902762280 1:18590020-18590042 GGAGAAGGAGGAGGGCTCTGGGG - Intergenic
903326714 1:22573020-22573042 GGAGCAGCTGGCTGGCTCTTTGG + Intronic
905455614 1:38086038-38086060 GGAGCAGCTGGCCAGCTGTGGGG - Intergenic
905546465 1:38804157-38804179 GGAGAGGTTCGCGGGCTCAGCGG - Intergenic
905908676 1:41638981-41639003 GGAGAAGAAGGCTGGCCCTGAGG + Intronic
906553362 1:46686024-46686046 TGAGAAGTTGGGAGGATCTGAGG - Intronic
907477635 1:54716013-54716035 GGAGAAGGTGGGCGGTCCTGGGG + Exonic
912429467 1:109621341-109621363 GGAGGAGGTGGCCCCCTCTGAGG - Intronic
914652966 1:149712888-149712910 GCAGAACGAGGCCGGCTCTGCGG - Intergenic
916219851 1:162433244-162433266 GGAGCAGCCGGCCGGCCCTGCGG + Intergenic
916517183 1:165530285-165530307 GGAGAAGTAGCCAGGCTTTGTGG + Intergenic
916712264 1:167422150-167422172 GGAGAGGTTGGCAGGGTCTGGGG - Exonic
916884484 1:169053747-169053769 GGAGAGGTTGGCAGGGGCTGTGG - Intergenic
916929504 1:169560713-169560735 GGAGAAGATGGACGACGCTGTGG - Exonic
920312968 1:205059192-205059214 GGAGTAGTTGCCCAGGTCTGAGG - Exonic
920497324 1:206464564-206464586 GGAGAAGGTGGCTGGCTGTAAGG - Intergenic
921496611 1:215850452-215850474 GGAGCAATTGGCCGTCTATGAGG + Intronic
922776543 1:228216706-228216728 GGAGCAGCTGGCAGCCTCTGCGG + Intronic
1067101328 10:43336807-43336829 GGAGCAGGTGGCTGGCCCTGAGG + Intergenic
1069871113 10:71533701-71533723 GGAGAGGTTGGAGGGCTTTGGGG + Intronic
1074991278 10:118710568-118710590 GGAGAAGTTAGCCAGCTTAGTGG - Intronic
1077488707 11:2850753-2850775 GGAGACAAAGGCCGGCTCTGGGG - Intergenic
1083273041 11:61581428-61581450 GGAGGAGGTGGCCGGCTCTGCGG - Intergenic
1084331586 11:68433596-68433618 GGAGCAGGTGGGCGGCTCTGGGG - Exonic
1085694181 11:78689914-78689936 GGGGAAGTTGGATGCCTCTGCGG + Intronic
1091358764 11:134958084-134958106 GGGGGAGCTGGCTGGCTCTGAGG - Intergenic
1091399337 12:172945-172967 GGAGAAGAAGGACGGCTCAGTGG + Intronic
1092471756 12:8787357-8787379 GGAGCAGCCGGCCGGCCCTGCGG + Intergenic
1095945463 12:47751103-47751125 GGAGGAGTTGGCCGAAGCTGTGG - Exonic
1096473953 12:51896672-51896694 GTAGAAGTTGGCAGGAGCTGGGG - Intergenic
1096552580 12:52382971-52382993 GGAGAAGTTGGCCTGGTCTGTGG + Intronic
1096622751 12:52874552-52874574 GGAGAATTTGTCCCGCTCTAGGG + Intergenic
1098172523 12:67761117-67761139 GTAGGAGTTAGCCGCCTCTGCGG + Intergenic
1098208869 12:68141435-68141457 GGATAAGTTGGGGAGCTCTGGGG - Intergenic
1099716246 12:86296672-86296694 GGAGCCGCTGGCCGGCCCTGCGG - Intronic
1103081560 12:118028064-118028086 GGAGAAGGTAGCCTGCTTTGGGG + Intronic
1107341798 13:39415093-39415115 GGACAAGTTGGCCTGTCCTGGGG - Intronic
1107461402 13:40607062-40607084 GGAGAAGTTGGGCAGATGTGCGG - Intronic
1113798031 13:113070026-113070048 GGAGGAGTTGACCGTCTGTGTGG - Intronic
1116423088 14:44756353-44756375 TGAGAAGTTGGCCATCTATGAGG - Intergenic
1117543232 14:56769177-56769199 GGGGAAGTAGGCCGGCGCGGTGG + Intergenic
1119037183 14:71240351-71240373 CGAGACCTTGGCCGGCTCAGTGG + Intergenic
1119219706 14:72896362-72896384 GGAGAAGTTTGGCAGTTCTGGGG + Intergenic
1120330966 14:83092475-83092497 GGAGCAGCCGGCCGGCCCTGCGG + Intergenic
1120816192 14:88861291-88861313 GGAGAAGTAACCCTGCTCTGTGG + Exonic
1121526849 14:94625181-94625203 AAAGAAGTTGGGTGGCTCTGGGG + Intergenic
1123984726 15:25635267-25635289 GGAGAAGGTGGCCATCTGTGAGG - Intergenic
1125134159 15:36322414-36322436 AGAGAAGATGGCTTGCTCTGGGG - Intergenic
1127615186 15:60677531-60677553 TGAGAAGTTGCCTGACTCTGAGG - Intronic
1132617437 16:848734-848756 GGAGAAGGTGGACGGCTCTCGGG - Intergenic
1132858052 16:2056260-2056282 GGTGAAATGGGCCGGCCCTGGGG - Intronic
1132903018 16:2268520-2268542 GGAGGGGTTCGCAGGCTCTGCGG + Intergenic
1134438984 16:14286225-14286247 GGAGAAGATGGAGGGCTCTGGGG + Intergenic
1135751083 16:25059180-25059202 GGAGCAGCCGGCCGGCCCTGCGG - Intergenic
1136564947 16:31064225-31064247 GGAGAAGGTGTCAGGCTCCGCGG - Exonic
1136573241 16:31108945-31108967 GGAGAGGTCGCCCGGGTCTGGGG + Intronic
1138631004 16:58294027-58294049 GGACCAGTTGGCCCGCACTGTGG + Exonic
1142080328 16:88145756-88145778 AGAGCAGTTGCCCGGCACTGGGG - Intergenic
1142941883 17:3386510-3386532 GGAGAAGATGGCCGTCTCCGCGG - Intergenic
1143519468 17:7437390-7437412 GGAGAATTGGCCCGGCTCCGCGG + Exonic
1146013201 17:29212167-29212189 GGAGAAGGTGGCCCTCTCTTGGG - Intergenic
1150653836 17:67026917-67026939 GGAGCAGGTGGCGGGCACTGGGG - Intronic
1151466230 17:74287252-74287274 AGAGAAGTGGCCCTGCTCTGGGG + Intronic
1152281355 17:79386595-79386617 GGGGAAGGTGTCTGGCTCTGTGG - Intronic
1152608891 17:81306114-81306136 GGAGAGGAGGGCCGGCCCTGGGG + Intergenic
1154496202 18:14963155-14963177 GGGGGAGCTGGCTGGCTCTGAGG + Intergenic
1157342515 18:46791888-46791910 GGAGCAGTTGCCAGGCTTTGGGG - Intergenic
1157533720 18:48443154-48443176 GGTGAAATTGGCTGGCTGTGAGG - Intergenic
1157574924 18:48737134-48737156 GGAGAAGTTGGCTAGTTCTGTGG + Intronic
1157622785 18:49025882-49025904 GGGGAGGTTGGCCCGCCCTGAGG - Intergenic
1158551019 18:58436475-58436497 GGAGAGGTAACCCGGCTCTGGGG + Intergenic
1158588788 18:58762674-58762696 GGAGAAGTTGGAGGTCTCTGTGG - Intergenic
1159460297 18:68714949-68714971 GGAAGAGTTGGACGGCCCTGCGG - Exonic
1161304150 19:3557597-3557619 GGCGCAGTCGCCCGGCTCTGGGG - Intronic
1163790571 19:19303788-19303810 AGAGAAATTGGCCCGCTTTGTGG - Exonic
1165096176 19:33411080-33411102 GGAGATGTGGGCAGGCCCTGCGG - Intronic
1165778226 19:38417435-38417457 CGAGAAGTTGGGCGGATTTGGGG + Intronic
1166801365 19:45459593-45459615 AGAGAGGTTGGCCGGGTGTGTGG + Intronic
1166843633 19:45713180-45713202 GGAGAAGGTGGCCTTCTTTGTGG - Exonic
1166852464 19:45767206-45767228 GGAGCAGCTGGCTGGCTATGCGG - Intronic
1167071804 19:47226382-47226404 GGAGTCCTTGGGCGGCTCTGCGG + Intronic
1168239209 19:55080863-55080885 GAAGAAGTTGGCAGGGTCTCTGG + Intronic
1168535175 19:57163106-57163128 GAAGAAGTTGGCCGGGTTGGGGG - Intronic
928619387 2:33073015-33073037 GGTCACGTTGCCCGGCTCTGTGG - Intronic
929140857 2:38665628-38665650 GCAGTAGTTGGCCGGCTCGGTGG - Intergenic
929670208 2:43871535-43871557 GGAGAAGTTGGGCTGGTCGGGGG - Intronic
934789488 2:97046631-97046653 GGAGATGGAGGCCGGCTCTCCGG - Intergenic
934816984 2:97335909-97335931 GGAGATGGAGGCCGGCTCTCCGG + Intergenic
934820712 2:97372575-97372597 GGAGATGGAGGCCGGCTCTCCGG - Intergenic
935735608 2:106104522-106104544 GGTGAAGTTGCCCAGCTCTGAGG - Intronic
937534039 2:122864205-122864227 GGCGAAGTTGGCCAGCAGTGGGG + Intergenic
939301324 2:140343918-140343940 AGAGAAGTGGGCAGGGTCTGGGG + Intronic
944857951 2:203785843-203785865 GGAGCAGCCGGCCGGCCCTGCGG - Intergenic
948065413 2:235075015-235075037 GGAGAAGTCAGCCAGCTCTTGGG + Intergenic
948195872 2:236095801-236095823 GTGGAAGTTGGCCAGCTCTTAGG - Intronic
948322956 2:237085741-237085763 GGAGGACCTGGCCGGCTCCGCGG - Exonic
1171346782 20:24471160-24471182 GGAGAAGTTGGCCGGCTCTGGGG - Intronic
1172836697 20:37877810-37877832 GCAGAAGCTGACAGGCTCTGGGG + Intergenic
1173863354 20:46298425-46298447 GGAGAAGTTGGTAGATTCTGAGG + Intronic
1175353795 20:58346055-58346077 GGAGAAGGTGTCCAGCACTGAGG - Intronic
1175888008 20:62303141-62303163 CGAGAAGGTGGCCGGCGCGGCGG + Intronic
1176386390 21:6140320-6140342 GGAGGAGGTGGCCCACTCTGTGG + Intergenic
1178851846 21:36218910-36218932 GAAGAAGTTGCCCTGCTCTCTGG + Intronic
1179737083 21:43397932-43397954 GGAGGAGGTGGCCCACTCTGTGG - Intergenic
1180183715 21:46129364-46129386 GGCGAACTTGGCCCGCTCGGCGG - Intronic
1182659865 22:31917538-31917560 AGAGAAACTGGCCAGCTCTGGGG + Intergenic
1183429598 22:37757682-37757704 GGAGCAGCGGGCGGGCTCTGAGG + Exonic
1183789611 22:40055417-40055439 GGAGAAGATGACCGGCACAGCGG + Intronic
1184175920 22:42788631-42788653 GGGGAAGTTGGCGGGCTCGCTGG + Intergenic
1184458031 22:44622333-44622355 GGAGCTGCTGGCTGGCTCTGGGG + Intergenic
1203278585 22_KI270734v1_random:110046-110068 GGAGAACTTGGATGGCTCCGGGG + Intergenic
950032070 3:9859994-9860016 GCAGAGGTTGCCCGTCTCTGTGG + Intergenic
950678124 3:14566870-14566892 TAAGAAGTTGGCCCTCTCTGAGG + Intergenic
952746595 3:36787653-36787675 TGAGAAGTGGGCAGCCTCTGTGG - Intergenic
958503019 3:94938116-94938138 CGAGAAGTCGGCCGGCAGTGGGG + Intergenic
959502065 3:107118171-107118193 GCAGCAGTTGGCAGGTTCTGTGG - Intergenic
966593973 3:181710665-181710687 GGAGAAGGCGGCCGGGACTGGGG - Intergenic
968466529 4:754358-754380 GGAGCAGGTGACCGGCTCTCGGG - Intronic
968903473 4:3441633-3441655 GCAGATGGTGGCCAGCTCTGTGG + Intergenic
969408357 4:7010525-7010547 GGAGGAGTGGGGCGGCTCTAGGG + Intronic
972578186 4:40371287-40371309 GGAGATGTTGGCCGGTACAGTGG + Intergenic
979290833 4:118977318-118977340 GGAGCAGCTGGCCAGCCCTGCGG - Intronic
979416136 4:120441161-120441183 GGAGAAGTGGGCTGGTTCTCAGG - Intergenic
981364117 4:143881868-143881890 GGCCAAGTTGGCTGCCTCTGAGG - Intronic
985025765 4:185737651-185737673 GGAGAAGGCGGCTGCCTCTGCGG + Intronic
985490709 5:176893-176915 GCAGAGGTTGGTCAGCTCTGTGG - Intronic
988924426 5:35975102-35975124 GGAGAAGTTGGCCTGTTCTGTGG + Intronic
990380789 5:55220704-55220726 GGAGGAGTTGGTCAGCGCTGCGG - Exonic
997261159 5:132466522-132466544 GAGGAAGTGGGCCGGCACTGGGG - Intronic
997528516 5:134568448-134568470 GCTGAGGTTGGCGGGCTCTGGGG + Intronic
1002428008 5:179187074-179187096 GGAGAGGGCAGCCGGCTCTGGGG - Intronic
1003323902 6:5077331-5077353 GAAAAAGTGGGCAGGCTCTGTGG + Intergenic
1006937465 6:37728403-37728425 AGAGAAGTTGGGAGGCTCTGGGG - Intergenic
1010731294 6:79394271-79394293 GGAGAATCTGGCCTGATCTGAGG - Intergenic
1010819475 6:80396283-80396305 GGAGAAAGTGGCCAGCCCTGTGG - Intergenic
1013497281 6:110710625-110710647 TGAGAAGATGGCAGTCTCTGAGG - Intronic
1017347599 6:153403032-153403054 GGAGTATTTGGCCACCTCTGTGG + Intergenic
1017717695 6:157223800-157223822 AGAGAAGTTGGGGGGCCCTGAGG + Intergenic
1018433100 6:163738365-163738387 GGAGAACCTGGCCTGCTGTGAGG - Intergenic
1018861299 6:167712569-167712591 GCAGAATCAGGCCGGCTCTGAGG - Intergenic
1019835531 7:3379319-3379341 GGAGAAGTTGCCCTGCGCTGAGG + Intronic
1019944285 7:4314206-4314228 GGAGCAGCCGGCCGGCCCTGCGG - Intergenic
1019965768 7:4497198-4497220 GGAGCAGCAGGCCGGCCCTGCGG - Intergenic
1021854997 7:24846661-24846683 GGAGAACTTGGTAGGCTGTGGGG + Intronic
1022539385 7:31121816-31121838 GGAGAGGTTTGCCTGCCCTGTGG + Intergenic
1022902573 7:34825476-34825498 AGAGAAGCTGGCTGGCGCTGTGG + Intronic
1028794112 7:94884995-94885017 GAAGAAGCTGGCCGGCACGGTGG - Intergenic
1029135378 7:98366762-98366784 GGGGGAGTTGGCTGGCTCTGGGG - Intronic
1031560956 7:123237543-123237565 GGAGAAGTGGACAGACTCTGGGG + Intergenic
1031635062 7:124092242-124092264 GTAGAAGTTGGTCAGCTGTGAGG - Intergenic
1036695241 8:10969981-10970003 GGTGAACTTGGCAGGGTCTGTGG - Intronic
1046768718 8:118097906-118097928 GGAGAATTTGGCCTTGTCTGAGG + Intronic
1049123262 8:140759567-140759589 GAAAAAGTTGGCTGGCTCAGTGG + Intronic
1049151980 8:141040927-141040949 GCAGAAGCTGGCAGGCCCTGGGG + Intergenic
1049826311 8:144671039-144671061 GGAGAAGCTTGGCGGCCCTGAGG - Intergenic
1050668664 9:7970819-7970841 GGGAAAGTTGGCCAGCTCTTAGG - Intergenic
1051342951 9:16128432-16128454 GCTGAAGTTGGCAGGCCCTGAGG - Intergenic
1059737597 9:117117870-117117892 GGTGAACTTCGCAGGCTCTGGGG + Intronic
1060055363 9:120408534-120408556 GGTGGAATTGGCCTGCTCTGTGG - Intronic
1062114508 9:134800896-134800918 GGAGAAGGTGGCTGGCCCTGAGG - Intronic
1062426935 9:136510453-136510475 GGAGGAGCAAGCCGGCTCTGGGG + Intronic
1062482861 9:136760487-136760509 GGAGGAGGTGGGCGGCTCTGAGG - Intronic
1062682253 9:137788182-137788204 GCAGAAGCTGGGCTGCTCTGTGG + Intronic
1187139029 X:16575544-16575566 GGAGCAGCTGGCCGGCCCTGCGG + Intergenic
1192510255 X:71717087-71717109 CGGGAAGGTGGCCGGCTCCGGGG + Exonic
1192516442 X:71764466-71764488 CGGGAAGGTGGCCGGCTCCGGGG - Exonic
1196108196 X:111918342-111918364 GGAGAAGTTGGCAGGGTGTGTGG + Intronic