ID: 1171346783

View in Genome Browser
Species Human (GRCh38)
Location 20:24471161-24471183
Sequence CGGAGAAGTTGGCCGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346783_1171346789 -2 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346783_1171346792 12 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346783_1171346794 13 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346783_1171346790 -1 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346783_1171346791 11 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346783_1171346796 24 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346783_1171346795 18 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346783 Original CRISPR CGGAGAAGTTGGCCGGCTCT GGG (reversed) Intronic
903122653 1:21226277-21226299 CGTGGAAGTTGTCCCGCTCTTGG - Intronic
913195929 1:116455840-116455862 CTGAGCAGTAGGCCAGCTCTAGG - Intergenic
916712265 1:167422151-167422173 AGGAGAGGTTGGCAGGGTCTGGG - Exonic
918098383 1:181352902-181352924 AGGAGCAGTGGGCCGGCTCCAGG + Intergenic
920414778 1:205791640-205791662 TGGAGAAGTTGTCCGGGTCCAGG + Exonic
1076372197 10:129963195-129963217 CAGAGAAGTTGCCCAGCCCTCGG + Intronic
1076660685 10:132054232-132054254 CGGAGGAGCTGGCAGGCTCAGGG + Intergenic
1077025709 11:438981-439003 CAGAGAGGGAGGCCGGCTCTGGG + Intronic
1083054265 11:59804672-59804694 TGGAGAAGATGGCTGGCTCCAGG + Intergenic
1084331587 11:68433597-68433619 GGGAGCAGGTGGGCGGCTCTGGG - Exonic
1084406090 11:68974511-68974533 CGGAGCAGCTGGCCGGCCCCAGG - Intergenic
1090245817 11:125215133-125215155 CGGAGCAGTTGGGAGGCTCTCGG + Intronic
1091655998 12:2347511-2347533 CACAGAAGTTGGCAGGCTCTAGG + Intronic
1092259881 12:6947095-6947117 CGGAGAAGTTGGCTGGACGTGGG - Intronic
1096622750 12:52874551-52874573 GGGAGAATTTGTCCCGCTCTAGG + Intergenic
1101538697 12:105644408-105644430 GGGAGAAGATGGCTGGGTCTGGG + Intergenic
1101771966 12:107760653-107760675 GGGAGAAGTTGGGCGGCCCCGGG - Exonic
1102272143 12:111546310-111546332 CAGAAAAGTTTGCCAGCTCTTGG - Intronic
1117251805 14:53946715-53946737 CGGATGAGCGGGCCGGCTCTCGG + Intergenic
1117920295 14:60721716-60721738 CGGAGCAGCTGGCCTGCTCGCGG + Intronic
1118487851 14:66230875-66230897 AGGAAAAGTTGGCTGACTCTTGG - Intergenic
1121710739 14:96037941-96037963 GGGAGGAGGTGGGCGGCTCTTGG + Intergenic
1132617438 16:848735-848757 GGGAGAAGGTGGACGGCTCTCGG - Intergenic
1134438983 16:14286224-14286246 GGGAGAAGATGGAGGGCTCTGGG + Intergenic
1141981345 16:87552175-87552197 CTGAGAAGTGGGCTGGCTCCCGG + Intergenic
1142080329 16:88145757-88145779 CAGAGCAGTTGCCCGGCACTGGG - Intergenic
1143657006 17:8300892-8300914 AGGAAAAGCTGGCCTGCTCTGGG - Intergenic
1144168225 17:12633296-12633318 CCCAGAAGCTGGTCGGCTCTGGG - Intergenic
1144431210 17:15193462-15193484 CGGAGAAGGTTGTGGGCTCTAGG + Intergenic
1146013202 17:29212168-29212190 TGGAGAAGGTGGCCCTCTCTTGG - Intergenic
1151466229 17:74287251-74287273 CAGAGAAGTGGCCCTGCTCTGGG + Intronic
1154127218 18:11702331-11702353 GGAAGAAGGAGGCCGGCTCTGGG - Intronic
1161304151 19:3557598-3557620 CGGCGCAGTCGCCCGGCTCTGGG - Intronic
940378706 2:152988336-152988358 AGAAAAAGTTGGCTGGCTCTTGG + Intergenic
948065412 2:235075014-235075036 TGGAGAAGTCAGCCAGCTCTTGG + Intergenic
1168915326 20:1480636-1480658 GGGAGAAGGTGGCCGTCTATAGG + Intronic
1169257049 20:4107538-4107560 GGGAGAAGGTGGCCGCCTATCGG - Intergenic
1171346783 20:24471161-24471183 CGGAGAAGTTGGCCGGCTCTGGG - Intronic
1175087104 20:56468769-56468791 CAGTGATGTGGGCCGGCTCTTGG + Intronic
1182659864 22:31917537-31917559 CAGAGAAACTGGCCAGCTCTGGG + Intergenic
1185380326 22:50504882-50504904 CGTAGGAGTTGGCCAGCTGTAGG + Exonic
950518976 3:13485101-13485123 CTGGGAAGTTGGCCGGGCCTTGG + Intronic
952954762 3:38550128-38550150 CGGAGCAGTTGGCCTGTGCTTGG - Exonic
955719860 3:61869202-61869224 CAGAGAAGTTGGCAATCTCTAGG - Intronic
963605903 3:147411397-147411419 CGGAGAAAGTGGCTGGCTCCCGG + Intronic
968466530 4:754359-754381 AGGAGCAGGTGACCGGCTCTCGG - Intronic
969408356 4:7010524-7010546 CGGAGGAGTGGGGCGGCTCTAGG + Intronic
977823384 4:101502408-101502430 AGAAGAATTTGGCCTGCTCTGGG + Intronic
978207205 4:106092662-106092684 GGGAGCAGCCGGCCGGCTCTGGG - Intronic
982217476 4:153094916-153094938 CTGAGATGTTGGCCGCCTCTGGG - Intergenic
1002139830 5:177132263-177132285 CGGAGCAGGCGGCCCGCTCTGGG + Intergenic
1006937466 6:37728404-37728426 TAGAGAAGTTGGGAGGCTCTGGG - Intergenic
1019316553 7:389647-389669 CGGAGAGGTTGGCAGGCTCGGGG - Intergenic
1019567101 7:1689681-1689703 CAGGGAAGTTGGCTGGCTCAAGG - Intronic
1024940586 7:54759245-54759267 CGGAGGAGTGGGCGGGCTGTTGG - Exonic
1027361839 7:77416804-77416826 CACAGAAGTAGGCCGTCTCTTGG + Intergenic
1029135379 7:98366763-98366785 TGGGGGAGTTGGCTGGCTCTGGG - Intronic
1029449326 7:100632132-100632154 GGGAGAAGTCCGCTGGCTCTGGG + Exonic
1030102130 7:105956026-105956048 CGGAGCAGTCCGCCGGCTCCGGG - Intronic
1034562967 7:151893639-151893661 GGGAGGAGTGGGCTGGCTCTGGG + Intergenic
1047642331 8:126833811-126833833 CGGAGAAATTGTACGGCTTTAGG - Intergenic
1062131581 9:134897104-134897126 CGGAGAAGAGGGAGGGCTCTAGG - Intergenic
1197166074 X:123379137-123379159 GGGAGAAGTTGGCTGGCTCCTGG - Intronic