ID: 1171346784

View in Genome Browser
Species Human (GRCh38)
Location 20:24471162-24471184
Sequence ACGGAGAAGTTGGCCGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 76}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346784_1171346790 -2 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346784_1171346794 12 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346784_1171346795 17 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346784_1171346792 11 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346784_1171346789 -3 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346784_1171346791 10 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346784_1171346796 23 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346784 Original CRISPR ACGGAGAAGTTGGCCGGCTC TGG (reversed) Intronic
902100396 1:13983253-13983275 ACGGAGGGGTTGGGAGGCTCAGG + Intergenic
902919592 1:19657968-19657990 GGGGAGAAGGCGGCCGGCTCTGG - Exonic
905319676 1:37106984-37107006 AGGGAGGAGATGGCCTGCTCTGG - Intergenic
915865518 1:159494699-159494721 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
921903800 1:220475760-220475782 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
921983638 1:221285749-221285771 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1066544212 10:36482089-36482111 ATGGAGAGGTTGGGAGGCTCAGG + Intergenic
1076660684 10:132054231-132054253 TCGGAGGAGCTGGCAGGCTCAGG + Intergenic
1077532959 11:3105890-3105912 AGGGAGAAGTGGGCAGACTCAGG - Intronic
1082003449 11:47407333-47407355 AGGGAGAAGTTGGCGGTCTAAGG + Intronic
1084107443 11:66989063-66989085 ACGGAGGGGGTGGCAGGCTCAGG - Intergenic
1092572385 12:9739667-9739689 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1096154860 12:49336286-49336308 AGGGAGAGGTGGGCCGGCGCGGG - Exonic
1101771967 12:107760654-107760676 CGGGAGAAGTTGGGCGGCCCCGG - Exonic
1110792366 13:79600249-79600271 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1111747705 13:92291115-92291137 ACGGAGCAGTGGGGAGGCTCAGG - Intronic
1113426626 13:110213704-110213726 AGGGAAAAGGTGCCCGGCTCTGG + Intronic
1118609715 14:67530757-67530779 ATGGGGCAGTTGGCCTGCTCTGG - Intronic
1120557942 14:85953700-85953722 ATGGGAAAGTTGGCCGGATCAGG - Intergenic
1122008627 14:98727278-98727300 ACAGAGCAGTCGGCAGGCTCAGG - Intergenic
1122789060 14:104176767-104176789 ACGGAGGTGGTGGCCTGCTCGGG + Exonic
1125625427 15:41104828-41104850 ACTGATAAGTTGGCCGGGTGTGG - Intronic
1143657007 17:8300893-8300915 AAGGAAAAGCTGGCCTGCTCTGG - Intergenic
1143868580 17:9941752-9941774 ACGGAGAGGTTGCACAGCTCGGG - Intronic
1150103984 17:62448187-62448209 ACGGAGAATTTGGAAGGCCCAGG - Intronic
1150207031 17:63416837-63416859 AGGGAGAAGGTGGCGGTCTCGGG + Intronic
1155976801 18:32140092-32140114 ACGGAGAGGGTGGGAGGCTCAGG - Intronic
1159977879 18:74738447-74738469 AAGGAGAAGTTGGCCGGGTGTGG + Intronic
1160163533 18:76492229-76492251 ACGGAGATGCTGCTCGGCTCAGG + Intronic
1168535177 19:57163108-57163130 AGGAAGAAGTTGGCCGGGTTGGG - Intronic
926176098 2:10593704-10593726 ACGGAGAAGTTGCTTGGCTGAGG + Intronic
926326195 2:11786467-11786489 AAGGAGAAGGTGGCAGGGTCAGG - Intronic
937071488 2:119067095-119067117 AAGGAGAAGTTGGTAGGCTGGGG + Intergenic
939903242 2:147877078-147877100 ACGTAAAAGTTGGCCAGCTGTGG + Intronic
944402901 2:199348801-199348823 ACGGAAGAGTTGGTTGGCTCTGG + Exonic
948530015 2:238598262-238598284 ACAGAGAAGTTGGCCTGCCGAGG - Intergenic
1171346784 20:24471162-24471184 ACGGAGAAGTTGGCCGGCTCTGG - Intronic
1172793147 20:37519983-37520005 TCGGAGAAGTTGGCAGATTCTGG - Intronic
1173870864 20:46341391-46341413 AAGGAGAAGGTGGCCGTGTCAGG - Intergenic
1176296266 21:5075141-5075163 ACGGAGGAGTTTGCTGGCTGTGG - Intergenic
1177496963 21:21902694-21902716 ACGGAGAGGGTGGGAGGCTCAGG - Intergenic
1177565800 21:22818949-22818971 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1179860783 21:44186980-44187002 ACGGAGGAGTTTGCTGGCTGTGG + Intergenic
1182659863 22:31917536-31917558 ACAGAGAAACTGGCCAGCTCTGG + Intergenic
1182842939 22:33406654-33406676 ACAGAGAAGTTGGCATGCCCAGG + Intronic
1185156044 22:49194141-49194163 CCGGAGGAGGTGGGCGGCTCTGG - Intergenic
1203278583 22_KI270734v1_random:110044-110066 AGGGAGAACTTGGATGGCTCCGG + Intergenic
957665150 3:83217701-83217723 ACGGAGAAGGTGGGCGGCTCAGG + Intergenic
965288077 3:166843082-166843104 ACGGAGAGGGTGGGCAGCTCAGG - Intergenic
975055433 4:69924161-69924183 ACGGAGCAGGTGGGAGGCTCAGG - Intergenic
976716976 4:88133705-88133727 AAGGAGAATTTGGCCGGGTGTGG + Intronic
979688624 4:123538187-123538209 ACGGAGGAGGTGGGAGGCTCAGG - Intergenic
982080194 4:151782095-151782117 AAAGAGAAGCTGGCTGGCTCAGG - Intergenic
982217477 4:153094917-153094939 TCTGAGATGTTGGCCGCCTCTGG - Intergenic
989097053 5:37791462-37791484 CCTGAGAAGCTGGCAGGCTCTGG - Intergenic
989633536 5:43511376-43511398 ACGGAGCGGCTGGCCGGGTCGGG - Intronic
999444139 5:151625666-151625688 ACTGAGAAGATGGCCGGGTGCGG + Intergenic
1001406082 5:171478703-171478725 ACTGTGAAGTTTGCAGGCTCTGG + Intergenic
1002397302 5:178968027-178968049 ACGGGGAAGGTGGCCGGGTGCGG - Intergenic
1003770123 6:9290530-9290552 ACGGAGGGGGTGGGCGGCTCAGG + Intergenic
1004235513 6:13872011-13872033 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1006937467 6:37728405-37728427 ATAGAGAAGTTGGGAGGCTCTGG - Intergenic
1009407076 6:63326540-63326562 ACGGAGGAGGTGGGAGGCTCAGG + Intergenic
1010274696 6:73955971-73955993 ACAGAGAAGTTGTCTGCCTCAGG + Intergenic
1010914179 6:81595288-81595310 ACGGAGAAGTCGGCAGTCTGCGG - Intronic
1015445132 6:133294869-133294891 AAGAAGAAATTGGCCGGCTGTGG - Intronic
1019316554 7:389648-389670 TCGGAGAGGTTGGCAGGCTCGGG - Intergenic
1019944233 7:4314027-4314049 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1023876102 7:44287096-44287118 AGGGAGAAGGTGGCCAGCTGGGG + Intronic
1027698251 7:81437179-81437201 ACGGAGAGGGTGGGAGGCTCAGG + Intergenic
1029429796 7:100523026-100523048 ACGGGGCAGCTGGCCGGCTGGGG + Intergenic
1030102131 7:105956027-105956049 TCGGAGCAGTCCGCCGGCTCCGG - Intronic
1034562966 7:151893638-151893660 AGGGAGGAGTGGGCTGGCTCTGG + Intergenic
1038373457 8:27014687-27014709 ACTCAGAAGTTGCCCGTCTCTGG + Intergenic
1043346490 8:79303765-79303787 ACGGAGAGGGTGGGAGGCTCAGG - Intergenic
1049440519 8:142607367-142607389 AGGGAGAAGTTAGCCGGTTGTGG + Intergenic
1060189508 9:121583095-121583117 ACGGAGAAGCTGGCCGGCCGCGG + Intronic
1061025927 9:128049467-128049489 GTGGAGAAGTTGGCCGGGTACGG + Intergenic
1194310670 X:92301899-92301921 ACAGAGAAGTCGGCCAGTTCAGG - Intronic
1196845086 X:119890861-119890883 ACGGAGAGGGTGGGAGGCTCAGG - Intergenic
1200618951 Y:5416184-5416206 ACAGAGAAGTCGGCCAGTTCAGG - Intronic