ID: 1171346785

View in Genome Browser
Species Human (GRCh38)
Location 20:24471168-24471190
Sequence CCTAGCACGGAGAAGTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346785_1171346789 -9 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346785_1171346790 -8 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346785_1171346791 4 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346785_1171346792 5 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346785_1171346799 30 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346799 20:24471221-24471243 TCGGAAGTGGTCTTCAAAGAGGG 0: 1
1: 0
2: 2
3: 7
4: 88
1171346785_1171346796 17 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346785_1171346794 6 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346785_1171346795 11 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346785_1171346798 29 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346798 20:24471220-24471242 ATCGGAAGTGGTCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346785 Original CRISPR CCTAGCACGGAGAAGTTGGC CGG (reversed) Intronic
903825218 1:26139968-26139990 CCTGGCACAGAGAAATTGGTTGG - Intergenic
904459381 1:30666524-30666546 CCCAGCTCGGAGAAGGTGGGGGG + Intergenic
908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG + Intronic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
918534949 1:185563980-185564002 CCTAGGACTGAGAAGTTTCCAGG + Intergenic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
920801556 1:209192906-209192928 CCCAGCAAGGAGAAATTTGCAGG + Intergenic
922606421 1:226892474-226892496 CCTGGCACGCAGCAGTGGGCTGG - Intronic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1078860386 11:15241082-15241104 CCTAGCAAAAAGAAGTTGGGTGG - Intronic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1087398220 11:97630660-97630682 CCTAGCAAGGTAAAGTTAGCTGG - Intergenic
1087643538 11:100781542-100781564 CCAAGCACCGAGAATTTGTCAGG + Intronic
1087740459 11:101881297-101881319 CCAACCACGAAGAAGTTGGAGGG + Intergenic
1088967338 11:114736986-114737008 GCTAGCACTCAGAGGTTGGCAGG - Intergenic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1093981652 12:25481391-25481413 CCTAGCACAGAGAACATAGCAGG + Intronic
1104076829 12:125397258-125397280 CATAGAACAGTGAAGTTGGCTGG - Intronic
1106283069 13:28294633-28294655 CCTTGCACAGGGAAGTTTGCTGG - Intronic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1110405410 13:75145003-75145025 CCTAGGACTGAGGAGTTGTCTGG - Intergenic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1125221037 15:37335777-37335799 CCTACTTCTGAGAAGTTGGCAGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136031293 16:27504998-27505020 CCTAGCACGGAGTAGATGCATGG - Intronic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1140055824 16:71524784-71524806 CCTAGCACGGGAAAGATGGCAGG + Intronic
1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG + Intronic
1146957706 17:36946422-36946444 GCCAGCCCGGAGAAGTTGGGTGG - Intergenic
1146996938 17:37329342-37329364 CCTAGCAGGTAGAAGTGGCCAGG + Intronic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1150950266 17:69795639-69795661 CCTATCATTCAGAAGTTGGCTGG - Intergenic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1161613735 19:5258016-5258038 CCTCGCACGTAGAGGTTGGCAGG + Exonic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167443759 19:49525462-49525484 ACGAGCACGGAGGACTTGGCTGG - Exonic
925932699 2:8722860-8722882 TCCAGCATGGAGCAGTTGGCAGG - Intergenic
928964992 2:36966852-36966874 CCTCGCACGCGGAAGTTCGCGGG + Intergenic
929052689 2:37851385-37851407 CCTGGCACCGAGAAGTAGGTGGG + Intergenic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174764981 20:53245090-53245112 ACCAGCACTGAGAAGTTGGGAGG + Intronic
1175423342 20:58849765-58849787 CCTAGCACGGTGAAGGAAGCAGG - Intronic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG + Intronic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
962204435 3:133423511-133423533 CAAAGTACGGAAAAGTTGGCTGG - Intronic
962944285 3:140153374-140153396 CCTTGCAGTGAGAATTTGGCGGG + Intronic
965994478 3:174862938-174862960 CCAAGTACAGAGGAGTTGGCTGG + Intronic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
984375589 4:178924610-178924632 CCTAGCACTGTCTAGTTGGCTGG - Intergenic
989600175 5:43193170-43193192 TCAAGCACGCAGAAGCTGGCTGG - Exonic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1007622229 6:43222294-43222316 CCTAGCAAGGATACGTTGGGAGG - Exonic
1015213157 6:130720783-130720805 CCTCGCACAGAGAAGTCGACTGG + Intergenic
1021117506 7:16760457-16760479 ACTAGGATGGAGAAGATGGCAGG + Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1038350063 8:26768002-26768024 TCTGGCACTGAGATGTTGGCCGG - Intronic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1051517739 9:17949596-17949618 CATAGCACTGAGAACTAGGCTGG - Intergenic
1053519435 9:38763200-38763222 CCAAGCAAGGAGAATTGGGCAGG - Intergenic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG + Intronic
1191850168 X:65580500-65580522 CATAGCTCTGTGAAGTTGGCAGG - Intergenic