ID: 1171346789

View in Genome Browser
Species Human (GRCh38)
Location 20:24471182-24471204
Sequence CGTGCTAGGCTGCGACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 56}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346778_1171346789 24 Left 1171346778 20:24471135-24471157 CCTGTGGGGTGAGCAGCCTCATA 0: 1
1: 0
2: 3
3: 16
4: 112
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346777_1171346789 30 Left 1171346777 20:24471129-24471151 CCTGCGCCTGTGGGGTGAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346780_1171346789 8 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346785_1171346789 -9 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346784_1171346789 -3 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346782_1171346789 -1 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346781_1171346789 0 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56
1171346783_1171346789 -2 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346789 Original CRISPR CGTGCTAGGCTGCGACCTCA AGG Intronic
900498256 1:2986703-2986725 CGTGCAAGGCTGCCCCCTCGGGG + Intergenic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG + Intronic
907826071 1:58017896-58017918 AGTGCTGGGCTGCAGCCTCAAGG - Intronic
914445129 1:147743829-147743851 AGTGCTAGACTGAGACCTCTAGG + Intergenic
919808934 1:201397165-201397187 CGTGCTAGGGTGTGACAGCACGG - Intronic
1067246438 10:44550536-44550558 CTTGCTAGGCTGCTCCTTCATGG + Intergenic
1075948841 10:126460258-126460280 CGTGCTAGGCTGTGAGCTCCAGG + Intronic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1084837601 11:71813928-71813950 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1092401099 12:8180141-8180163 CGTCCTGTGCTGCCACCTCATGG + Intronic
1094753394 12:33439301-33439323 CGCGCTAGGCTGCAAGCTCCGGG - Intronic
1103717322 12:122952504-122952526 CCCTCTAGGCTGCCACCTCATGG - Intronic
1124071009 15:26393276-26393298 CATGCTAGGCTGTGAGCCCATGG + Intergenic
1131972850 15:97909485-97909507 CGTGTTAGGCTGCCCTCTCATGG - Intergenic
1133139090 16:3731380-3731402 CCTGCTCAGCTGTGACCTCATGG - Exonic
1133280573 16:4662838-4662860 GGTGCTTGGCTGCGGGCTCAGGG + Intronic
1139752986 16:69120358-69120380 CGTGCTCCGCTGCCACCTCGAGG - Exonic
1139798306 16:69500477-69500499 CGGCCTAGCCTGAGACCTCACGG + Intergenic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1149616043 17:58000018-58000040 GGTGCTAGGCTGGGATTTCAGGG - Intronic
1151235736 17:72718571-72718593 CGTGCCTGGCTGTGACCCCAAGG - Intronic
1156471753 18:37381479-37381501 CCTGCAAGGCTCCCACCTCAAGG - Intronic
925702829 2:6656111-6656133 CGTGCTTGCCTGGAACCTCAAGG - Intergenic
930261789 2:49155219-49155241 AGTGCTGGGCTGTCACCTCAGGG - Intergenic
935765744 2:106366274-106366296 CGTGCTCTGCTGCAGCCTCAGGG - Intergenic
940729766 2:157375479-157375501 CCTGCTAGGCGGTGCCCTCATGG + Intergenic
941143589 2:161815656-161815678 GATGCTAGGCTTCAACCTCAAGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1172153914 20:32810461-32810483 CGGGCTAGGCTGGGACCACAGGG - Intergenic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176268354 20:64222394-64222416 CGTGCCCAGCTGCGGCCTCAGGG - Intronic
1184118868 22:42437739-42437761 CTTGCTAGGCGGTGGCCTCAGGG - Intergenic
1184228235 22:43143039-43143061 CGTGCTGGGCTACGACCTGCTGG - Exonic
1184358282 22:43997022-43997044 CTTGCTGGGCTGCGTCCTCCTGG + Intronic
1184415801 22:44351090-44351112 CGTGCGAGGCTGAGACCTTTGGG - Intergenic
962756277 3:138467718-138467740 TGTGCTAGGCTCCATCCTCAGGG + Intronic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
969779018 4:9381439-9381461 CGTCCTGTGCTGCCACCTCATGG - Intergenic
974384461 4:61187047-61187069 CATGCTAAGCTGCTAACTCAGGG - Intergenic
978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG + Intergenic
989105582 5:37860258-37860280 TGTACTTGGCTGTGACCTCAGGG - Intergenic
998026863 5:138824634-138824656 CCTTATAGGCTGCGACATCAGGG - Exonic
1006831407 6:36970422-36970444 CCTGCTAGTTGGCGACCTCATGG - Exonic
1013788844 6:113813083-113813105 GAAGCTAGGCTGAGACCTCATGG + Intergenic
1015961142 6:138650383-138650405 CCTGCTAGTCGGCGACCTCATGG - Intronic
1026534398 7:71228195-71228217 CCTGCTTGGCTGGGACATCAGGG - Intronic
1031732729 7:125318399-125318421 AGTTCTAGGCTGGGATCTCAAGG + Intergenic
1032322378 7:130897133-130897155 TGTGCGAGGCTGCCACCTCGTGG - Intergenic
1036276457 8:7355398-7355420 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG + Intergenic
1048925151 8:139264893-139264915 CTTGCTGGGCTGCAACCTGAGGG - Intergenic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG + Intergenic
1061537251 9:131257835-131257857 GGTGCAAGGCTGAGACCGCAGGG + Intergenic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1062419125 9:136470927-136470949 CGCGCTAGGCTGCGCCTTCCAGG - Intronic
1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG + Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic